We narrowed to 9,396 results for: CAG
-
Plasmid#99851PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP1
Plasmid#184556PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Gria3-GFP KI
Plasmid#131491PurposeEndogenous tagging of GluA3: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.2-RBD
Plasmid#184830PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.2 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA2-RBD (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.2 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pαH-S-GSAS-OMICRON.BA.1-RBD
Plasmid#184831PurposeMammalian cell expression of RBD of SARS-CoV-2 spike protein of variant OMICRON.BA.1 with furin side replaced by GSAS and with 2 Proline substitution at 986 and 987DepositorInsertS-GSAS-OMICRON.BA.1 (S Severe acute respiratory syndrome coronavirus 2)
Tags6X His tagExpressionMammalianMutationSARS-CoV-2 Spike RBD protein of OMICRON.BA.1 vari…Available SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-1
Plasmid#125776Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-1 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD051-sgMLH1-2
Plasmid#125777Purposeconstitutive expression of a guide RNA targeting human MLH1 (CRISPR cutting control) and S. pyogenes Cas9DepositorInsertsgMLH1-2 (MLH1 Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJT230 lenti pEF-rTetR(SE-G72P)-3XFLAG-NCOA3-TAD-T2A-mCherry-BSD-WPRE
Plasmid#188763PurposeLentiviral backbone containing NCOA3 as a fusion with rTetR(SE-G72P)-3XFLAGDepositorInsertNCOA3 (NCOA3 Human)
UseLentiviralTagsrTetR(SE-G72P)-3xFLAGExpressionMammalianPromoterpEF1aAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12R/sgKras/Cre
Plasmid#99852PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12R mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13D/sgKras/Cre
Plasmid#99857PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13D mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgWRN-EIJ
Plasmid#125774Purposeconstitutive expression of a guide RNA targeting an exon-intron junction of human WRNDepositorInsertsgWRN-EIJ (WRN Human)
UseCRISPRAvailable SinceJune 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR1A_mmFbxw7(res) (closed)
Plasmid#160105PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
HK1 gRNA (BRDN0001147564)
Plasmid#77644Purpose3rd generation lentiviral gRNA plasmid targeting human HK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-4-EF1a-LibVec
Plasmid#239600Purposeexpresses guide#4 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-sgPlxnb2-KO-2-EF1a-LibVec
Plasmid#239598Purposeexpresses guide#2 to knock-out mouse Plxnb2, via CRISPR-Cas9DepositorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
Plasmid#184557PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi systemDepositorInsertKirsten rat sarcoma virus (Kras Mouse)
UseCRISPR, Lentiviral, and Mouse TargetingTagsFlagExpressionBacterialAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
Anti-CASK [K56A/50R-2b]
Plasmid#222168PurposeMammalian Expression Plasmid of anti-CASK (Human). Derived from hybridoma K56A/50.DepositorInsertAnti-CASK (Homo sapiens) recombinant mouse monoclonal antibody. (CASK Mouse)
ExpressionMammalianPromoterDual CMVAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD hCPS1 TL
Plasmid#188150PurposeExpresses C-terminal flag-tagged human CAD hCPS1 TL in mammalian cellsDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationTCC -> AGT silent mutations at nt439-441 elimi…Available SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7WT-VA
Plasmid#115187PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7WT into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7WT (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7V51G-VA
Plasmid#115188PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7V51G into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7C53A-VA
Plasmid#115189PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7C53A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7H126A-VA
Plasmid#115190PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7H126A into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7H126A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-CR-PARK7E163K-VA
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX304_zeo_mmFbxw7(res)
Plasmid#160106PurposeExpresses murine Fbxw7 alpha with a T199 silent mutation in mammalian cells. The T199 silent mutation confers resistance to the 5'-TGAACATGGTACAAGGCCAG-3' sgRNADepositorAvailable SinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 UBE2C guide 1
Plasmid#117068Purposesingle guide RNA targeting UBE2C; guide 1DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
px330 Gatad2a sgRNA (for deletion)
Plasmid#110814PurposeExpressed sgRNA for generating Gatad2a deletion (knockout ) in mouse cell linesDepositorInsertmGataD2a (Gatad2a Mouse)
ExpressionMammalianAvailable SinceDec. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCX-TRI-2A
Plasmid#74674Purposemammalian expression of TRI-2A (hHO1/F2A/hCD73/F2A/hCD39)DepositorTagsF2AExpressionMammalianPromoterpCAGGSAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CASK
Plasmid#23470DepositorInsertCASK (CASK Human)
UseGateway donor vectorAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
P3-dCas9-Tet1-GFP-Puro
Plasmid#190728PurposeExpression of human spdCas9-Tet1 fusion for targeted DNA methylation in mammalian cell. EGFP-puromycin double marker under an independent CMV promoter. Cloning backbone for spgRNA (BbsI)DepositorInsertdCas9-tet1
UseCRISPRTags3XFLAG and SV40 NLSExpressionMammalianMutationChanged Pro434 codon from CCG to CCC and Gly468 f…PromoterpCAGAvailable SinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shABC1
Plasmid#186713PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC1 = shARAF.381-shBRAF.2015-shCRAF.2446). The shABC2 set is better than shABC1.DepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9(BspMI/SapI/BsaI_cassettes)-T7-gRNA1 (BPK1807)
Plasmid#223065PurposeDual pT7 entry plasmid for SpCas9(6AA) library; bacterial expression plasmid with type IIS RE cassettes around D1135/S1136, G1218/E1219, R1335/T1337 (precursor to MMW94). Expresses a gRNA.DepositorInsertentry vector for human codon opt. bacterial expr. plasmid for SpCas9(6AA_NNS) library, with gRNA targeting EGFP site 1
UseCRISPRTagsNLS(SV40)-3xFLAGExpressionBacterialMutationThree regions of SpCas9 encode type IIS restricti…PromoterDual T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003-sgMYC
Plasmid#125770Purposeconstitutive expression of a guide RNA targeting human MYC (CRISPR positive control)DepositorInsertsgMYC (MYC Human)
UseCRISPRAvailable SinceJune 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1277
Plasmid#29140PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceSept. 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 PSMB5 guide 1
Plasmid#117073Purposesingle guide RNA targeting PSMB5; guide 1DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1157
Plasmid#29072PurposePlasmid described in Yang et al., Genomics, 2009 (PMID: 18950699).DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSAvailable SinceJan. 25, 2012AvailabilityAcademic Institutions and Nonprofits only -
pXPR_BRD003 PSMB5 guide 2
Plasmid#117074Purposesingle guide RNA targeting PSMB5; guide 2DepositorAvailable SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1293
Plasmid#29144DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsCreAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-DIO-SaCas9-U6-sgDaglb
Plasmid#240023PurposeKnockdown expression of DaglbDepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-DIO-SaCas9-U6-sgDagla
Plasmid#239421PurposeKnockdown expression of DaglaDepositorAvailable SinceJan. 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(ARID1B(21))-PGKpuroBFP-W
Plasmid#200507PurposeLentiviral vector expressing gRNA targeting human ARID1A and ARID1BDepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide2
Plasmid#125514PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide1
Plasmid#125513PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 ZFAND3-guide3
Plasmid#125515PurposeCRISPR-mediated activation of ZFAND3. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR.DepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEMS1164
Plasmid#29079DepositorInsertCAG promoter
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-CreAvailable SinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only