We narrowed to 24,790 results for: Spr
-
Plasmid#136513PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cellsDepositorInsertcodon-optimized AcrIIA5
TagsFLAG/NLSExpressionMammalianPromoterCMVAvailable SinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pXD71Cas10.1RT1-Pct5.1-crRNA(dadR)-RT(ΔdadR)
Plasmid#191635PurposeE. coli - Eggerthella lenta shuttle plasmid (KanR), cumate-inducible promoter Pct5.1-crRNA(dadR-targeting spacer) dadR-deleting repair template, used for dadR deletionDepositorInsertCymR
UseCRISPRExpressionBacterialAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pShCAST(Cas12k-TniQ)-sgRNA_entry (CJT11)
Plasmid#181787PurposeExpresses 3-component ShCAST containing a Cas12k-TniQ fusion. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShTnsB, ShTnsC, ShCas12k-ShTniQ
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TRE-mRuby3
Plasmid#214923Purposeexpression vector control - contitutive expression of mRuby33 aloneDepositorInsertmRuby3
UseLentiviralAvailable SinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS186
Plasmid#140627PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS186. The crRNA-IS186 targets IS186 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS186
UseCRISPR; TransposonExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS23: pHelper(PmcCAST)_entry_ΔTnsD
Plasmid#168156PurposeInducible expression of PmcCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB and TnsC)
PmcTniQ
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_FOXP1
Plasmid#86261PurposeDonor vector for 3' FLAG tag of human FOXP1DepositorAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC010 LshCas13a locus with nontargeting spacer
Plasmid#91901PurposeLshCas13a locus into pACYC184 with nontargeting spacerDepositorInsertLshCas13a locus with non-targeting spacer
ExpressionBacterialAvailable SinceOct. 16, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
AA007
Plasmid#216002PurposeFragmid fragment: (Cas protein) canonical Cas9; NGG PAMDepositorHas ServiceCloning Grade DNAInsertCas9_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA032
Plasmid#216012PurposeFragmid fragment: (Cas protein) deactivated CasDepositorHas ServiceCloning Grade DNAInsertdCas9_v1.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA427
Plasmid#215961PurposeFragmid fragment: (guide cassette) enables iBar UMIsDepositorHas ServiceCloning Grade DNAInsertU6_v1; BsmBI_v0; BsmBI_v5; trRNA_v6 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-POLI-ST2-com vector
Plasmid#176234PurposeVector plasmid for expressing spCas9-POLI fusion protein and sgRNA. There are two copies of HBB 3’ UTR in the 3’UTR of spCas9-POLI to enhance expression. The ST2 loop of the sgRNA scaffold was replaceDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC008_pLKO-U6-BsmBI-chRNA(+85)-EFS-Thy11
Plasmid#192147PurposeT cell CRISPR lentiviral vectorDepositorTypeEmpty backboneExpressionMammalianMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KAT7
Plasmid#86266PurposeDonor vector for 3' FLAG tag of human KAT7DepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_multi1-3-MS2-Puro
Plasmid#192683PurposeLentiviral expression of multi gNAs targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNAs #1,2,3 (MYOD1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
G1333 DddAtox-C–SaKKH-Cas9(D10A)
Plasmid#157838Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertG1333 DddAtox-C–SaKKH-Cas9(D10A)–UGI–SV40 NLS
ExpressionMammalianAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMS3: pHelper(AvCAST)_AvPSP1_ΔTnsD
Plasmid#168135PurposeInducible expression of AvCAST proteins (except TnsD) with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS21: pHelper(PmcCAST)_entry
Plasmid#168154PurposeInducible expression of PmcCAST proteins. Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB, TnsC and TnsD)
PmcTniQ
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330_ACTB-i1 sgRNA / hSpCas9
Plasmid#172825PurposeMammalian expression of a sgRNA targeting the intron 1 position 1 of ACTB (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting the intron 1 of ACTB under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB2903(XI-2 MarkerFree)
Plasmid#73275PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-2 (Chr XI: 91575..92913)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS1026-pMCSG7-HpaCas9
Plasmid#121540PurposeExpresses a 6X-His tagged type II-C Cas9 from H. parainfluenzae in bacterial cellsDepositorInsertHpaCas9
ExpressionBacterialAvailable SinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KDM6A
Plasmid#86265PurposeDonor vector for 3' FLAG tag of human KDM6ADepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7780 mU6:- || CMV: mCherry~P2A-DD-AcrIIA4
Plasmid#123658PurposeDD-AcrIIA4 fusion for Shield1-mediated AcrIIA4 control without sgRNA following mU6 promoter.DepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromotermU6Available SinceApril 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
G1397 DddAtox-N–SaKKH-Cas9(D10A)
Plasmid#157839Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertG1397 DddAtox-N–SaKKH-Cas9(D10A)–UGI–SV40 NLS
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-rac2-guides
Plasmid#168241Purpose"neutrophil specific GFP with ubiquitous rac2 sgRNAs"DepositorInsertrac2 sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPPC001
Plasmid#171138PurposeFor integration of Sp.pCas9-dCas9 and BBa_J23107-MCP-SoxS(R93A/S101A) with miniTn7T methodDepositorInsertSp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPRExpressionBacterialMutationSoxS has R93A and S101A mutationsPromoterSp.pCas9, BBa_J23107Available SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKS7107
Plasmid#89051PurposeExpresses Nm crRNA, Nm tracrRNA and human codon-optimized NmCas9DepositorInsertsNm crRNA
Nm tracrRNA
hNmCas9
UseCRISPRTagsHA tag, NLS, and SV40 NLSPromoterEF1a and human U6Available SinceApril 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS1027-pMCSG7-SmuCas9
Plasmid#121541PurposeExpresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cellsDepositorInsertSmuCas9
ExpressionBacterialAvailable SinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAcrF2
Plasmid#89234PurposePlasmid contains the gene for anti-CRISPR protein AcrF2 (gene 30 from bacteriophage D3112), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF2
Tags6xHis-TEVAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330 _HITI donor B6
Plasmid#172847PurposeDRS-2 sgRNA expression under a U6 promotor and HITI donor B6 (Zhong et al, eLife 2021), mEGFP translational phase (1-1), excised by DRS-2 sgRNA (with SpCas9).DepositorInsertDRS-2 sgRNA and HITI donor (phase 1) encoding mEGFP
UseCRISPRExpressionMammalianAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCfB3039(XII-2 MarkerFree)
Plasmid#73279PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XII-2 (Chr XII: 808805..809939)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain
Plasmid#101205PurposeBacterial expression plasmid for SpCas9 REC3 domainDepositorInsertSpCas9 variant K506–Q712
Tags10x His, MBP, and TEV siteExpressionBacterialMutationK506–Q712PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CEBPG
Plasmid#86285PurposeDonor vector for 3' FLAG tag of human CEBPGDepositorAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Px458-Cas9n-Trp63-Exon4-1sgRNA
Plasmid#88848PurposeCRISPR KO of Trp63DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pQCascade-IS3
Plasmid#140626PurposeExpresses V. cholerae TniQ, Cas8, Cas7, and Cas6 and crRNA-IS3. The crRNA-IS3 targets IS3 loci in Escherchia coli.DepositorInsertVchTniQ, VchCas8, VchCas7, VchCas6, crRNA-IS3
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_GATAD2A
Plasmid#86279PurposeDonor vector for 3' FLAG tag of human GATAD2ADepositorAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgITGB4-3
Plasmid#121536PurposesgITGB4-3 sequence: GAGGAGCGTAGGTCCTCGCAG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgITGB4-3
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceNov. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS24: pCascade(PmcCAST)_entry
Plasmid#168157PurposeInducible expression of PmcCAST Cascade proteins. Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
ExpressionBacterialAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Exon.1
Plasmid#78540PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralExpressionMammalianPromoterU6 and U6 (for expressing sgRNA)Available SinceJuly 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-3-3xFLAG-dCas9-HA-2xNLS
Plasmid#106354PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_MED13_iso1
Plasmid#135733PurposeDonor vector for 3' FLAG tag of human MED13_iso1DepositorAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCfB3036(XI-1 MarkerFree)
Plasmid#73274PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-1 (Chr XI: 67491..68573)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAcrF1
Plasmid#89233PurposePlasmid contains the gene for anti-CRISPR protein AcrF1 (gene 35 from bacteriophage JBD30), with N-terminal 6his tag and TEV protease cleavage siteDepositorInsertAcrF1
Tags6xHis-TEV and FLAGAvailable SinceApril 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJMP1341
Plasmid#119272Purposecontrol sgRNA in cells lacking rfpDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZLCv2-gD4Z4-1-3xFLAG-dCas9-HA-2xNLS
Plasmid#106352PurposeCRISPR/Cas9 engineered chromatin immunoprecipitation of D4Z4 locusDepositorInsertD4Z4 gRNA-1
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -