We narrowed to 2,326 results for: dcas9
-
Plasmid#60074PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_80
Plasmid#60072PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRa_all-in-one
Plasmid#183695PurposeExpresses CRISPRa components including dCas9-VP64, Synergistic Activation Mediators (SAM), mCherry, and gRNA expression cassette, blasticidin selectiveDepositorTypeEmpty backboneUseCRISPRAvailable SinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEG302_22aa_SunTag_MQ1(Q147L)_g4+g10+g18
Plasmid#172318PurposeCRISPR dCas9 SunTag system to target a variant of bacterial DNA methyltransferase MQ1 to install CG specific methylation to the FWA locus with three guide RNAsDepositorInsertg18_U6_g10_U6_g4_U6_NOS_MQ1(Q147L)_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceSept. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-UniSAM
Plasmid#99866PurposeEncodes for Cas9-VP64, MS2-p65-HSF1, mCherry and for the gRNA 2.0DepositorInsertUniSAM-mCherry + U6-gRNA2.0
UseCRISPR and Synthetic Biology; Dcas9-sam activationExpressionMammalianMutationBbsI sites in CDS were ablated by consensus mutat…PromoterEF1aAvailable SinceAug. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a-DNMT3l
Plasmid#154140PurposeExpresses the scFv-GCN4-DNMT3a-DNMT3l fusion protein (more details are shown in the vectro map) for targeted DNA methylation. Should be used in a combination with the dCas9-SunTag systems.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPEPZ-sgRNAclone
Plasmid#141090PurposeThis vector is designed for efficient cloning of sgRNAs by Golden Gate assembly. The sgRNA insertion leads to replacement of mCherry, resulting in loss of red color of E. coli colony.DepositorInsertmCherry
UseCRISPRExpressionBacterialPromoterp3Available SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRi
Plasmid#199808Purposevector for constitutive CRISPRi-mediated gene knockdown in S. aureusDepositorInsertsdCas9
sgRNA with GFP cassette
UseCRISPRPromoterP23 and PRAB17 (sgRNA) and SarAP1 (GFP)Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#106249PurposeLentiviral vector with puro selection for expression of S. aureus dCas9-KRABDepositorInsertdead S. aureus Cas9 KRAB T2A PuroR
UseCRISPR and LentiviralTagsHA-NLS and NLS-KRABExpressionMammalianMutationD10A and N580APromoterhUbCAvailable SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCBE4-gam
Plasmid#124449PurposeExpresses dead Cas9 (dCas9)-CBE4-gamDepositorInsertdCBE4-gam
UseCRISPR and Synthetic BiologyExpressionMammalianMutationD10A, H840AAvailable SinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBTK615
Plasmid#110609PurposeBTK assembled plasmid - used in Stage 2 assembly to target Cas9 or dCas9DepositorInsertsgRNA
UseSynthetic BiologyAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_pCMV-dCas-PmCDA1 pH1-gRNA(HPRT)
Plasmid#79621PurposeExpresses dCas9-PmCDA1 and gRNA(HPRT) in mammalian cellsDepositorInsertSpCas9
TagsPmCDA1ExpressionMammalianMutationD10A and H840A for nuclease deficient Cas9PromoterpCMVAvailable SinceSept. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1
Plasmid#188963PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: atcggtcgcattgttttccactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgULK1-1
Plasmid#109004PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC0.017
Plasmid#119621PurposeLevel 0 Part. CDSDepositorInsertdCas9
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL2-2
Plasmid#109009PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pC0.018
Plasmid#119622PurposeLevel 0 Part. CDSDepositorInsertdCas9+deg-tag
UseSynthetic BiologyMutationbp 331 C to A , 1237 A to C, 1284 C to T, 2121 C …Available SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJOG250
Plasmid#80582Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG251
Plasmid#80583Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG252
Plasmid#80584Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG253
Plasmid#80585Purposerecipient plasmid [single activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
pAtU6-BpiI-ccdB_CmR-BpiI_sgRNA_scaffold
UseCRISPRExpressionPlantMutationD10AAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
scFv-GCN4-DNMT3a(R887E)-DNMT3l
Plasmid#154141PurposeExpresses a higher specificity variant of scFv-GCN4-DNMT3a-DNMT3l, contains R887E mutation in DNMT3a. To be used with the dCas9-SunTag system for targeted DNA methylation.DepositorInsertscFv-GCN4, DNMT3a (catalytic domain), DNMT3l (C-terminal part), sfGFP
TagsHA and sfGFPExpressionMammalianMutationR887EPromoterSFFVAvailable SinceOct. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_sgRNA_MS2_neo
Plasmid#118650PurposeTo clone sgRNA for activation dCas9DepositorTypeEmpty backboneUseLentiviralPromoterU6Available SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
dSpyCas9-p300-P2A-CASANOVA
Plasmid#113129PurposeCo-expresses dSpyCas9 fused to the p300 histone acetyltransferase core domain and CASANOVADepositorInsertdCas9-p300-P2A-CASANOVA
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Hbb
Plasmid#99692PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Hbb, vector allows for strong activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleAvailable SinceJan. 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pdCASclos
Plasmid#73640PurposeTranscriptional repression for gene Spo0A (CAC-2011) in Clostridium acetobutylicum ATCC 824DepositorInsertsdCas9
sgRNA to spo0A
UseE.coli-clostridium shuttle vectorMutationD10A, H840APromoterPj23119 and ptbAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGB 35s:dCas:BRD:tNos (GB1172)
Plasmid#75401PurposeTranscriptional unit of (human codon optimized) inactivated Cas9 fused to the BRD Transcriptional RepressorDepositorInsertdCas9:BRD
UseCRISPR and Synthetic BiologyExpressionPlantPromoter35SAvailable SinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-70kb-DSF
Plasmid#227498Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 70kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRI006-pYFAC-riboB-PgpdA-dSpCas9-VPR-TtrpC
Plasmid#140199PurposeEpisomal expression of dSpCas9-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdSpCas9-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSPromoterPgpdAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRDA_831
Plasmid#216100PurposeCRISPRa, EF1a-driven dCas9-VP64 (Cas only)DepositorInsertCas9 [Sp]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTK3_020
Plasmid#123735PurposeEncodes rapamycin and tamoxifen activated split-dCAS9 (C-terminal) as a Type 3 part to be used in the MTK systemDepositorInsertERT2-fkbp-spdCa9(205-1368)
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL1-5
Plasmid#109007PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEHE51
Plasmid#250522PurposeVector for sgRNA expression in Acinetobacter baumannii (CRISPRi). Modified version of pYDE007 (Plasmid #194152) made Golden Gate compatible (BsaI) for sgRNA oligo insertion.DepositorInsertTwo BsaI sites (T-BsaI-BfuI-BsaI-A) inserted between the J23119 promoter and dCas9 handle/gRNA scaffold
ExpressionBacterialPromoterJ23119Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-73kb-DSF
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only