We narrowed to 13,947 results for: CRISPR-Cas9
-
Plasmid#91884PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorAvailable SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only
-
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F2)-GFP
Plasmid#91877PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AOI-WT-Cas9-sg-mouse Gfi1-exon4(F1)-GFP
Plasmid#91883PurposeExpresses 3xFLAG-Cas9 and a gRNA targeting mouse Gfi1DepositorAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-dSaCas9-NLS-VPR
Plasmid#68495PurposeAAV vector containing nuclease null SaCas9 fused to VPRDepositorInsertdSaCas9
UseAAVTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET-dCas9-VP64-6xHis
Plasmid#62935PurposeExpression of dCas9-VP64-6xHis in bacterial cellsDepositorInsertdCas9-VP64
Tags3xFLAG, 6xHis, NLS, and VP64ExpressionBacterialMutationD10A and H840A amino acid changes render Cas9 nuc…PromoterT7Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
LLP339 pGK-dCas9-SunTag
Plasmid#100943PurposedCas9 vector with SunTagx10, driven by pGK, with 3xHA tag, Puro driven by EF1aDepositorInsertdCas9, SunTag array (10xGCN4)
UseCRISPRTags3xHAExpressionMammalianMutationD10A, H840A for dCas9Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVi U6_gRNA CMV_SadCas9-KRAB
Plasmid#214609PurposeAll-in-one AAVi plasmid expressing S. aureus dCas9-KRAB with sgRNA cassetteDepositorInsertsgRNA
SadCas9
UseAAVTagsNP NLS and SV40 NLSExpressionMammalianMutationD10A, N580APromoterCMV and U6Available SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Cas9-P2A-Puro
Plasmid#110837PurposeLentiviral vector for expression of Cas9 in mammalian cells (codon optimized)DepositorInsertCas9
UseLentiviralMutationWTPromoterEF1sAvailable SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xms2-2x3’UTR
Plasmid#122946PurposeFor expressing SaCas9 mRNA with one copy of MS2 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-MS2-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSaCas9-1xPP7-2x3'UTR
Plasmid#122947PurposeFor expressing SaCas9 mRNA with one copy of PP7 aptamer and 2 copies of HBB 3' UTRDepositorInsertSaCas9-PP7-HBB 3' UTR
UseAAVExpressionMammalianAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSB-XPRESSO-hSpCas9-EGFP
Plasmid#237298PurposeSleeping Beauty XPRESSO vector for Cas9-EGFP expressionDepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV_NLS-SaCas9-NLS-VPR
Plasmid#68496PurposeAAV vector containing SaCas9 fused to VPRDepositorInsertSaCas9-VPR
UseAAV and CRISPRTagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-mR2-ACTB_sgRNA
Plasmid#183884PurposepX459V2.0-HypaCas9 plasmid with mRuby2 reporter and ACTB sgRNA for N-terminal tagging of beta-actin in human cells.DepositorAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgGFP1-7SK-sgCas9
Plasmid#87908Purposemultiple sgRNADepositorInsertsgGFP1, sgCas9
UseGateway entry vectorPromoterH1, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
px458-Cas9 UPF1 sgRNA
Plasmid#251491PurposeCas9 CRISPR gRNA construct; expresses human UPF1 gRNADepositorInsertUPF1 gRNA
ExpressionBacterialAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-E690_guide-CBh-hSpCas9
Plasmid#188545PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid E690DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-W308_guide-CBh-hSpCas9
Plasmid#188546PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid W308DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-L101_guide-CBh-hSpCas9
Plasmid#188547PurposePlasmid encoding pCas9 and gRNA for mutagenesis or gene-correction of human ABCA3 mutation at amino acid L101DepositorInsertgRNA
UseCRISPRTagsT2A-EGFPPromoterU6Available SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-(BB)-2A-Puro-HsHelz-sgRNA_AH
Plasmid#148897PurposeMammalian Expression of HsHelz-sgRNADepositorAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
CRISPR plasmid
Plasmid#236553PurposeEncodes Cas9 and two guideRNAs, one to cut the genome downstream of HSPA5 (BiP/GRP78) and one to linearize the DONOR plasmid.DepositorInsertCas9
ExpressionMammalianAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
FUGW U6 gL1HSg2dCas9-KRAB-T2a-GFP
Plasmid#234881PurposeL1HS-silencing plasmid (CRISPRi gRNA2)DepositorInsertLacZ gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHRm-NLS-dCas9-GFP11x7-NLS
Plasmid#70224PurposeExpresses NLS-dCas9-GFP11x7-NLS in mammalian cellsDepositorInsertNLS-dCas9-GFP11x7-NLS
TagsGFP11x7ExpressionMammalianAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP
Plasmid#154139PurposeExpresses the dCas9-DNMT3a-DNMT3l-3xFLAG-tagBFP fusion protein for targeted DNA methylation.DepositorInsertdCas9, DNMT3a (catalytic domain), DNMT3l (C-terminal part), tagBFP
Tags3x FLAG and tagBFPExpressionMammalianPromoterCMVAvailable SinceOct. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SlugCas9-NNG-P2A-puro
Plasmid#214352PurposeExpresses SlugCas9-NNG and puromycin resistance genesDepositorInsertSlugCas9-NNG and puromycin resistance genes
ExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
Plasmid#185676PurposeSpCas9 and gRNA targeting the C-terminus of HsIRE1DepositorInsertERN1 gRNA (ERN1 Human)
UseCRISPRAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvolvR-mCherry-enCas9(D10A)-PolI5MΔ
Plasmid#249068PurposeExpresses nucleus-localized enCas9 (D10A) fused to PolI5MΔ and mCherry using a CMV promoter. Includes a GFP cassette flanked by BsmbI cut sites to knock in and coexpress user-defined gRNAs.DepositorInsertenCas9-PolI5MΔ
UseCRISPRTagsmCherryExpressionMammalianMutationdeletion of PolI5M N-terminal flap endonuclease d…PromoterCMVAvailable SinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRPromotermouse U6Available SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJSC120 - Bacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variant
Plasmid#101208PurposeBacterial expression plasmid for SpCas9 + N497A/R661A/Q695A, HNH FRET variantDepositorInsertSpCas9 variant C80S/C574S/S355C/S867C/N497A/R661A/Q695A
Tags10x His, MBP, and TEV siteExpressionBacterialMutationC80S, C574S, S355C, S867C, N497A, R661A and Q695APromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFGC-I2Cas9
Plasmid#173158PurposeExpresses Cas9 in dividing Arabidopsis cells. Contains dsRED and Basta for fast transformant selection.DepositorInsertshSpCas9
pNAP:dsRED:tNOS
pMAS:BAR:tMAS
ICU2 upstream regulatory region
Tags3xFLAG-NLS and NLSExpressionPlantMutationContains a D169N mutation with no visible effect …Available SinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTMN140 - UCOE-SFFV-VPH-XTEN-dCas9-IRES2-BFP-T2A-Blast
Plasmid#238166PurposeExpress VPH-dCas9 and BFP-T2A-BlasticidinR in mammalian cells. LentiviralDepositorInsertVPH-dCas9
UseCRISPR and LentiviralTagsmTagBFP2Available SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT3-NLS-3XHA-NLS
Plasmid#69223PurposeExpresses R1335K mutant SpCas9 in mammalian cellDepositorInsertSpCas9
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationArginine 1335 is changed to LysineAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT1-NLS-3XHA-NLS
Plasmid#69221PurposeExpresses R1333K mutant SpCas9 in mammalian cellDepositorInsertSpCas9
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationArginine 1333 is changed to LysineAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCSDest2-SpCas9-MT2-NLS-3XHA-NLS
Plasmid#69222PurposeExpresses R1333S mutant SpCas9 in mammalian cellDepositorInsertSpCas9
UseCRISPRTagsNLS-3XHA-NLSExpressionMammalianMutationArginine 1333 is changed to SerineAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTMt_NES_TCS(Q’G)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101101PurposeEncodes dCas9(N) fused to transmembrane tetherDepositorInsertTMt-dCas9(N)
UseCRISPR and Synthetic BiologyTagsHA and MycExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBDKRB2_TCS(Q’L)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101108PurposeEncodes dCas9(N) fused to BDKRB2DepositorInsertBDKRB2-dCas9(N)
UseCRISPR and Synthetic BiologyTagsFlag and HAExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAVPR2_TCS(Q’L)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101112PurposeEncodes dCas9(N) fused to AVPR2DepositorInsertAVPR2-dCas9(N)
UseCRISPR and Synthetic BiologyTagsFlag and HAExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPAR1_TCS(Q’L)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101116PurposeEncodes dCas9(N) fused to LPAR1DepositorInsertLPAR1-dCas9(N)
UseCRISPR and Synthetic BiologyTagsFlag and HAExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only