We narrowed to 11,581 results for: cas9 expression plasmid
-
Plasmid#42876PurposeBacterial expression of Cas9 nuclease, tracrRNA and crRNA guideDepositorInserttracr/Cas9
UseCRISPR; E.coliTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJUMP29[dCas9]-1A(lacZ)
Plasmid#126979PurposeLevel 1 vector. With lacZ as alternative cloning reporter.OriV 9 (pBBR322/ROP; medium copy number). Constitutive dCas9 in downstream secondary site.DepositorTypeEmpty backboneUseSynthetic BiologyTagsExpressionBacterialMutationCas9 catalytically deadPromoterAvailable sinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianMutationPromoterLP1B and hU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3A2
Plasmid#73435PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3A2.DepositorInsertRepressor 3A2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4A6
Plasmid#73434PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4A6.DepositorInsertRepressor 4A6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3F2
Plasmid#73428PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3F2.DepositorInsertRepressor C4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-4F2
Plasmid#73431PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 4F2.DepositorInsertRepressor 4F2 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1B6
Plasmid#73430PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1B6.DepositorInsertRepressor 1B6 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-3H5
Plasmid#73429PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 3H5.DepositorInsertRepressor 3H5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1D4
Plasmid#73433PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1D4.DepositorInsertRepressor 1D4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-1E4
Plasmid#73436PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 1E4.DepositorInsertRepressor 1E4 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-M-5F5
Plasmid#73432PurposeCRISPR synthetic transcription factor repressor plasmid encoding dCas9, tracrRNA, and a single spacer CRISPR array encoding crRNA for orthogonal repression of T7-lac promoter variant 5F5.DepositorInsertRepressor 5F5 (orthogonal T7-lac repressor)
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterConstitutive wild-type S. pyogenes promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX_311-Cas9
Plasmid#96924Purposefor Cas9 knockout, lentiviral expression of Cas9. Alternate plasmid name: pXR111DepositorInsertCas9
UseLentiviralTags3xFlag and V5ExpressionMammalianMutationPromoterEF1aAvailable sinceJune 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUB-Cas9
Plasmid#86556PurposeFor ubiquitous expression of Cas9 in planta. sgRNA can be introduced as described in Hahn et al. (2017)DepositorInsertCas9
UseCRISPRTagsExpressionPlantMutationCas9 is codon optimized for C. reinhardtiiPromoterUBIQUITIN10Available sinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-EGFP
Plasmid#106964Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-EFS-HypaSpCas9-P2A-puro
Plasmid#106965Purposesingle-vector CROPseq system with high fidelity SpCas9 (HypaSpCas9) for use in the CROPseq CRISPR knockout screenDepositorInsertHypaSpCas9
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFSAvailable sinceApril 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
UseTagsExpressionMutationPromoterQuorum sensing promoterAvailable sinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_NoFlag_hROSA26_Left
Plasmid#191442PurposeExpresses the hROSA26 left sgRNA in combination with FLAGless eSpCas9(1.1) to target the hRosa26 safe harbor locusDepositorInserthROSA26 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
LLP774_dCas9-Spy-Snoop-Sunx5-Avi-Tag-BFP (dCas9-SSSavi-BFP)
Plasmid#211767PurposedCas9 docking array with four tag domains (Spy, Snoop, aGCN4, Avi), with BFP selectionDepositorInsertdCas9, Spy, Snoop, aGCN4, AviTags
UseTags3xHAExpressionMammalianMutationdCas9 D10A and H840APromoterpGK and pEF1aAvailable sinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pdCas9
Plasmid#46569PurposeExpresses the tracrRNA, the dCas9 catalytic site mutant and a CRISPR array designed for the easy cloning of new spacers.DepositorInsertstracrRNA
dcas9
CRISPR array
UseCRISPRTagsExpressionBacterialMutationD10A, H840APromoterAvailable sinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A iRFP670 P2A puro
Plasmid#122182PurposeThe plasmid codes for a Flag-spCas9 protein, a iRFP670 fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsUseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A mNeonGreen P2A puro
Plasmid#122183PurposeThe plasmid codes for a Flag-spCas9 protein, a mNeonGreen fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsUseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti spCas9 T2A TagRFP-T P2A puro
Plasmid#122200PurposeThe plasmid codes for a Flag-spCas9 protein, a TagRFP-T fluorescent protein and a puromycin resistance. The plasmid has two BsmBI acceptor sites to insert gRNA expressing sequences.DepositorInsertsspCas9
TagRFP-T
UseLentiviralTagsT2AExpressionMammalianMutationPromoterAvailable sinceFeb. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-BFP-PGK-Blast
Plasmid#196720PurposeTet-inducible expression of Cas9-T2A-TagBFPDepositorInsertCas9-T2A-TagBFP
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSExpressionMutationPromoterTRE, PGKAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCW-Tet-Cas9-miRFP670nano-PGK-Blast
Plasmid#196722PurposeTet-inducible expression of Cas9-T2A-miRFP670nanoDepositorInsertCas9-T2A-miRFP670nano
UseCRISPR and LentiviralTags3xFLAG-SV40NLS and Nucleoplasmin NLSExpressionMutationPromoterTRE, PGKAvailable sinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 alpha1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1656)
Plasmid#160618PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDGB3 omega1 Tnos:nptII:Pnos - SF - P35S:hCas9:Tnos (GB1657)
Plasmid#160640PurposeModule for the expression of the human codon optimized Cas9 and kanamycin resistance (NptII).DepositorInsertTnos:NptII:Pnos-SF-P35s:hCas9:tNos
UseCRISPRTagsExpressionMutationBsaI and BsmBI sites removedPromoterPnos, 35SAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET-21a_3xNLS_SpCas9_protein_expression
Plasmid#114365PurposeProtein expression plasmid for 3xNLS SpCas9 in pET-21a backboneDepositorInsert3xNLS_SpCas9
UseCRISPRTagsNLSExpressionBacterialMutationPromoterT7Available sinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
EC2_1_dCas9_sgRNA
Plasmid#163710PurposeYeast low copy plasmid with dCas9 and sgRNA expression cassetteDepositorInsertdCas9
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIgnaviCas9
Plasmid#127595PurposeExpresses IgnaviCas9 in E. coliDepositorInsertIgnaviCas9
UseTags6xHis Tag and Maltose binding proteinExpressionBacterialMutationPromoterT7 promoterAvailable sinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBLO1806_Cas9_2xNLS_human
Plasmid#74493PurposeHuman codon optimized plasmid to express Cas9 t2a mCherry w/2xNLS and a sgRNADepositorInsertCas9
UseTagst2a mCherryExpressionMammalianMutationPromoterAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
EC2_7_dCas9_HC_sgRNA
Plasmid#163711PurposeHigh copy plasmid with dCas9 and sgRNA expression cassettesDepositorInsertdCas9
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459)
Plasmid#48139PurposeNOTE: A new version of this plasmid is now available. See Addgene plasmid 62988.DepositorInserthSpCas9-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiV2-dCas9-VP64
Plasmid#141104PurposeExpression of gRNA and dCas9-VP64 from the same plasmid for CRISPRaDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJune 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9
Plasmid#162162PurposeExpresses hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTagsN/AExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-GAL-Hyg
Plasmid#232091PurposeYeast CEN plasmid for galactose-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertSpCas9 and Ec86 reverse transcriptase
UseCRISPRTagsExpressionYeastMutationEc86 reverse transcriptase is codon optimized for…PromoterGAL1-GAL10Available sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only