We narrowed to 15,163 results for: GRN
-
Plasmid#67640PurposeURA3 vector for cloning guide sequences using BclI-SwaI sites into guide RNA expression cassetteDepositorInsertsingle guide RNA expression cassette
UseCRISPRExpressionYeastPromoterpSNR52Available SinceAug. 31, 2015AvailabilityAcademic Institutions and Nonprofits only -
pRCC-N
Plasmid#81192PurposeExpression of Cas9 and gRNA cassette in S. cerevisiae; Nourseothricin ResistanceDepositorInsertsCas9
empty gRNA cassette
UseCRISPRTagsNTSExpressionYeastMutationPlease see depositor comments below. and WT - cod…PromoterROX3 and SNP52pAvailable SinceSept. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-CFP-SaCas9-HF (without sgRNA)
Plasmid#134470PurposeHuman expression vector for SaCas9-HF variant.DepositorInsertStaphylococcus aureus Cas9 nuclease (SauCas9) with high genome-wide specificity
UseCRISPRTagsSV40NLS-3xFLAGExpressionMammalianMutationR245A, N413A, N419A, R654APromoterCAGAvailable SinceNov. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-hROSA26-1-1kbdonor
Plasmid#234736PurposePseCAST crRNA targeting hROSA26-1, with 1 kb donor transposonDepositorInserthROSA26-1 crRNA
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E4orf6
Plasmid#64220PurposeExpression vector for sgRNA and Cas9 linked via T2A to BFP linked to the Ad4 E4orf6 gene via P2ADepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-BFP-P2A-E4orf6ExpressionMammalianPromoterCBh and U6Available SinceNov. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLB2 Ubi-FLIP FF
Plasmid#19753DepositorInsertoligo targeting Firefly luciferase
UseCre/Lox, Lentiviral, Mouse Targeting, and RNAiExpressionMammalianAvailable SinceDec. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
AAV-pCbh-SpRY[C-term]-gRNAentry (CA20)
Plasmid#197511PurposeCbh promoter expression plasmid for C-terminal intein-split AAV construct with C-term of SpRY and BsmBI entry cassette to clone SpCas9 gRNA spacerDepositorInsertAAV-[ITR]-pCbh-BPNLS-NpuC-SpRY[C-term]-BPNLS-gRNA[BsmBI]-pU6-[ITR]
UseAAV and CRISPRTagsBPNLS and BPNLS-NpuC(intein)MutationC-terminal mutations of SpRY(L1111R/D1135L/S1136W…PromoterCbhAvailable SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 Rheb1 shRNA #1
Plasmid#26625DepositorAvailable SinceOct. 22, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-TargetBC-5xTAPE-1-pegRNA-InsertBC
Plasmid#183790PurposeA single construct out of the pool of plasmid for lineage recording experiment using DNA Ticker Tape.DepositorInsertsP2A-eGFP-TargetBC-5xTAPE-1
pegRNA-InsertBC
UseSynthetic BiologyMutationG>A in the gRNA scaffold- please see depositor…Available SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shNRF2 #1
Plasmid#136584PurposeExpresses an inducible short hairpin targeting human NRF2 sequenceDepositorAvailable SinceJune 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-flex-dsRed-shvgat
Plasmid#67845PurposeExpresses shRNA to the vesicular GABA transporter VGAT. Cre dependent expression by flex switchDepositorInsertAAV-hsyn-flexed-dsRed-miR30-vgat2.shRNA
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterh-synapsinAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO human shRNA 1 DEPTOR
Plasmid#21335DepositorAvailable SinceJuly 6, 2009AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.PAC
Plasmid#57828PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_22A
Plasmid#91133PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: 35S:AtCas9 + AtU6:gRNA, Plant Selection: 2x35S:npt IIDepositorInsertEngineering Reagent: 35S:AtCas9 + AtU6:gRNA
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBLO 62.5
Plasmid#123124PurposeHuman expression vector for planctomyces CasX and sgRNADepositorInsertsCasX protein
CasX sgRNA
UseCRISPRExpressionMammalianAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA(MS2)-puro-barcode
Plasmid#89493PurposeCloning backbone for sgRNA, also has a barcode that allows detection from scRNA-seqDepositorInsertsgRNA (with MS2 loop)
UseLentiviralPromoterU6Available SinceJune 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
MoClo Plant Parts III: Transformation & Genome Engineering Kit
Plasmid Kit#1000000236PurposeCollection of MoClo Level 0 parts for plant transformation, including regulatory elements, coding sequences, basic CRISPR parts, and parts for modular geminiviral replicon assembly.DepositorApplicationCloning and Synthetic BiologyVector TypePlant ExpressionCloning TypeGolden Gate (MoClo)Available SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP
Plasmid#188899PurposedCas9 with an N-term Zim3 KRAB-NLS fusion, a C-term HA-2xNLS, and GFP linked by a P2A site from a SFFV promoter with an upstream ubiquitous chromatin opening elementDepositorInsertZim3-dCas9
UseLentiviralTagsHA-2xNLS, P2A-GFP, and Zim3 KRAB-NLS fusionPromoterSFFVAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-EFS-SaABE8eV106W-bGH-U6-sgRNA-BsmBI
Plasmid#189924PurposeAAV genome encoding SaABE8eV106W and Sa sgRNA cassette on a single AAV, with BsmBI sites for protospacer installationDepositorInsertSaABE8e V106W
UseAAVMutationSaCas9 D10A, TadA ABE8e V106WPromoterEFSAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human DGCR8-1
Plasmid#14769DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO-shBRCA1 #1
Plasmid#44594DepositorAvailable SinceMay 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
GAG-CRErec
Plasmid#119971PurposeExpresses GAG (FMLV) fused with CRE recombinase for the production of VLPs loaded with CRE proteinDepositorInsertGAG-nlsCRErec
TagsnlsExpressionMammalianPromoterhCMVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER.ATRi
Plasmid#14582DepositorAvailable SinceMarch 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_1
Plasmid#36387DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-hDDX5/17
Plasmid#71307PurposeInducible shRNA knockdown of both human DDX5 and DDX17 genesDepositorAvailable SinceDec. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
Luc-pSUPER-Retro-GFP/Neo
Plasmid#22133DepositorInsertsynthethic oligonucleotide
UseRNAi and RetroviralExpressionMammalianMutationsynthethic oligonucleotide encoding shRNA targeti…Available SinceOct. 14, 2009AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNASAM(gTetO)-TREGFP-PGKpuroBFP-W
Plasmid#112927PurposeCRISPR-a reporter assay lentiviral vector (gTetO)DepositorInserthU6-gRNASAM(gTetO), TREGFP, PGKpuroGFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
Px461-Cas9n-Trp53-sgRNA-alpha
Plasmid#88846PurposeCRISPR KO of Trp53DepositorAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
1255_pAAV-U6-SA-BbsI-MluI-gRNA-CB-SACas9-HA-OLLAS-spA
Plasmid#109320PurposePlasmid for AAV SaCas9 Mammalian Expression with a BbsI cloning site for a gRNADepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSimpleII-U6-sgRNA-BsmBI-NLS-NmCas9-HA-NLS
Plasmid#115694PurposeAll-in-one plasmid. Contains expression cassette for NmeCas9 with N and C NLS and HA tag at the C, plus cassette (for cloning of spacer in BsmBI) for expressing sgRNA under the control of U6 promoter.DepositorInsertsNmeCas9
Nme-sgRNA
UseCRISPRTagsNLS and NLS, HAExpressionInsect and MammalianMutationNone and fusion of repeat/tracrRNA to make a sgRNAPromoterEF-1 alpha and U6Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-Nme/Nme2Cas9-sgRNA (KAC32)
Plasmid#133794PurposeU6 promoter sgRNA entry vector used for all NmeCas9 or Nme2Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Amrani et al. Genome Biology 2018DepositorInsertNmeCas9 and Nme2Cas9 sgRNA entry vector
ExpressionMammalianMutationsgRNA architecture from Amrani et al. Genome Biol…PromoterU6Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSPromoterCytomegalo Virus(CMV)Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR
Plasmid#60225PurposeExpresses Cre recombinase and Renilla luciferase from the EFS promoter and one U6-driven sgRNA targeting LacZ. AAV backbone.DepositorInsertssgRNA
Renilla luciferase
Cre recombinase
UseAAV, CRISPR, Cre/Lox, Luciferase, and Mouse Targe…TagsCre-HA and Rluc-P2AExpressionMammalianPromoterEFS and U6Available SinceOct. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSEM318 - sgRNA mosTI unc-119 single-copy
Plasmid#159822PurposeSingle copy or array insertion by MosTI using split unc-119 selectionDepositorInsertsgRNA mosTI unc-119 single-copy
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPB-Ins-U6p-sgRNAentry-EF1Ap-TetOn3G-IRES-Neo
Plasmid#183411PurposepiggyBAC-based sgRNA entry (Esp3I) and Tet-On 3G transactivator expression vector. Insert protospacer and transfect with CRISPRa (183409) or CRISPRi (183410) plasmid for inducible epigenome editing.DepositorInsertTet-on 3G
UseCRISPR and Synthetic Biology; PiggybacExpressionMammalianPromoterEF1AAvailable SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
TBP6.7 non-targeting gRNA lambda phage
Plasmid#132547Purposeexpresses gRNA for TBP-based CIRTSDepositorInsertgRNA TBP-based CIRTS
ExpressionMammalianPromoterhU6 promoterAvailable SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-EF1aCore-SaCas9-dual(U6-sgRNA(backbone))-ITR
Plasmid#207878PurposeAAV vector encoding EF1a core promoter-driven SaCas9 and two sgRNA cloning sites w/ the engineered Sa Guide scaffold variant (BbsI and PaqCI for sgRNA cloning).DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceOct. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pZR158_Lenti-U6-gRNA-10xCS1-PP7_hPGK-PCP-P65-HSF1-Puro
Plasmid#180273PurposeLentiviral expression vector for CRISPRa-SAM sgRNA with 10x capture sequence, and PCP-P65-HSF1 cassetteDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV:ITR-U6-sgRNA(NeuN)-pCBh-Cre-WPRE-hGHpA-ITR
Plasmid#60227PurposeExpresses Cre recombinase from the Cbh promoter and one U6-driven sgRNA targeting the mouse gene NeuN. AAV backbone.DepositorInsertssgRNA
Cre recombinase
UseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsCre-HAExpressionMammalianPromoterCBh and U6Available SinceNov. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dCas9-ZIM3-KRAB-T2a-PuroR
Plasmid#172982Purposecontrol & cloning vector for CRISPRi expressing dead Cas9-ZIM3-KRAB fusionDepositorInsertcontrol sgRNA
UseCRISPR and LentiviralAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEJS476-pHAGE-TO-Nme dCas9 3XGFP-SgRNA/Telomere-All-in-one
Plasmid#85716PurposeExpresses dNmeCas9-3XsfGFP and telomere-targeting Nme sgRNADepositorInsertsNme dCas9
telomere sgRNA
UseCRISPR and LentiviralTags3XsfGFPExpressionMammalianPromoterCMV-TO and U6Available SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only