We narrowed to 15,152 results for: GRN
-
Plasmid#218529PurposesgRNA targeting human EIF2AK1/HRIDepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgRNA-Cre-GpNLuc
Plasmid#208382PurposeDerived from LentiCRISPRV2 by replacing Cas9 with Cre recombinase and puromycin resistance with GpNLuc. Contains a stuffer sequence for cloning of sgRNA of interest, as per LentiCRISPRV2.DepositorTypeEmpty backboneUseLentiviral and LuciferaseExpressionMammalianMutationWTAvailable SinceJan. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR-U6-gRNA-miniCMV-TdTomato
Plasmid#192656PurposeA plasmid encoding miniCMV sgRNA and miniCMV-promoter-TdTomatoDepositorInsertTdTomato
ExpressionMammalianPromoterU6, miniCMVAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-NQL005-SOX2-sgRNA
Plasmid#175553PurposeFor transient expression of spCas9-nuclease and a sgRNA targeting the mouse SOX2 locus.DepositorInsertspCas9-nuclease and sgRNA against mouse SOX2 STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceNov. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAC-CR7T-gRNA2.1-nlsBFP
Plasmid#170515PurposegRNA cloning vector containing a CR7T promoter, gRNA(2.1) scaffold, and a Ubi-mTagBFP-NLS marker; optimized for germline CRISPR.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterCR7TAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSEM253 - sgRNA mosTI hygroR
Plasmid#159827PurposeSingle copy or array insertion by MosTI using split hygroR selectionDepositorInsertsgRNA mosTI hygroR
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral sgRNA human CD19
Plasmid#155289PurposeLentiviral expression of sgRNA against human CD19DepositorInsertCD19 (CD19 Human)
Available SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-TRAF6-targeting sgRNA 2
Plasmid#131346PurposegRNA targeting mouse TRAF6DepositorAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Tsc2-g2)-PGKpuroBFP-W
Plasmid#105040PurposeLentiviral gRNA plasmid targeting mouse Tsc2 , co-expression of TagBFPDepositorAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO1-puro-U6-sgRNA-TGM2
Plasmid#69239PurposeU6 driven SpCas9 sgRNA expression for TGM2 siteDepositorAvailable SinceOct. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-scramble
Plasmid#62285Purposeexpression of scramble sgRNA from the arabinose-inducible promoterDepositorInsertscramble sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
HaloKu70 sgRNA
Plasmid#207583PurposesgRNA for the insert of the HaloTag at the endogenous loci of Ku70.DepositorInsertGAGCAGTAGCCAACATGTCA
ExpressionMammalianAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJC.15A.sgRNA.TA
Plasmid#232483PurposesgRNA cloning backbone for expression of sgRNA in C. difficile. Contains TA system to enable maintenence without antibiotic selection.DepositorInsertsToxin-antitoxin System from CD630
medium-copy-number p15A origin of replication
mCherry
UseCRISPRExpressionBacterialPromoterP3 constitutive promoter and native promoterAvailable SinceApril 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Cas9-hGem_gRNA2
Plasmid#217659Purposeexpresses Cas9-hGem and guideRNA targeting the human AAVS1 safe harbour locusDepositorInsertsgRNA2 targeting the human AAVS1 safe harbour locus
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 sgRNA
Plasmid#207559PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCAGCCAGGCCAGAAAGGTC
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ULK1 KO sgRNA
Plasmid#207561PurposepX330 expressing Cas9 and a sgRNA targeting the ULK1 locusDepositorInsertCCCGCCTGCGCCATGGAGCC
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgRNA-GFP
Plasmid#200068PurposeFor the knock down of GFP with an astrocyte specific mCherry expressionDepositorInsertU6-sgRNA-GFP
UseAAV, CRISPR, and Mouse TargetingTagsGfaABC1D-mCherryPromoterU6, GfaABC1DAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG5 sgRNA
Plasmid#207555PurposepX330 expressing Cas9 and a sgRNA targeting the ATG5 locusDepositorInsertAACTTGTTTCACGCTATATC
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PGAM1_sgRNA1
Plasmid#201614PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPGAM1 (PGAM1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV15_pCAG.Cas9.gRNA.S1
Plasmid#199259PurposeExpression construct encoding SpCas9 nuclease and an AAVS1-targeting guide RNADepositorInsertsSpCas9 nuclease
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AV44_pCAG.Cas9-D10A.gRNA.S1
Plasmid#199258PurposeExpression construct encoding SpCas9-D10A nickase and an AAVS1-targeting guide RNADepositorInsertsSpCas9-D10A nickase
AAVS1-targeting gRNA
UseCRISPRTagsSV40 NLSExpressionMammalianMutationD10APromoterCAG promoter and RNA polymerase III promoter for …Available SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2_NBT:Cas9green; erbb2_gRNA171
Plasmid#199337PurposepDEL134; transgenic construct to express cell-specific Cas9 in neurons; ubiquitous erbb2 sgRNADepositorInsertsNBT
Cas9
erbb2 sgRNA
UseTol2 destination vectorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTol2_claudink:Cas9green; control_gRNA
Plasmid#199336PurposepDEL143; transgenic construct to express cell-specific Cas9 in oligodendrocytes; ubiquitous control sgRNADepositorInsertsclaudink
Cas9
control sgRNA
UseTol2 destination vectorAvailable SinceApril 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_CmYLCVp_35sT_ribozyme_AtPDS3_gRNA10
Plasmid#197966PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by CmYLCVp, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterCmYLCVp and pUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pco-vCASphi_E9t_V2_pUB10_E9t_ribozyme_AtPDS3_gRNA10
Plasmid#197979PurposeT-DNA binary vector to express pco-vCasphi driven by UBQ10 gene promoter, and the AtPDS3 guide RNA 10 driven by UBQ10 gene promoter, flanked by ribozymes.DepositorInsertspco-vCasphi-2
AtPDS3 gRNA10
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-backbone
Plasmid#172517PurposeYeast plasmid encoding a 2-kb gRNA-placeholder flanked by BsmBI/Esp3I restriction sites to facilitate gRNA insertionDepositorInsertgRNA cassette
UseCRISPRExpressionYeastPromoterSNR52Available SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY2ShHELIX_sgRNA_entry (CJT30)
Plasmid#181781PurposeExpresses Y2-ShHELIX containing a nicking Y2 I-AniI fusion to ShTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertY2-nAniI-ShTnsB, ShTnsC, ShTniQ, ShCas12k
ExpressionBacterialMutationY2-nAniI = F13Y, S111Y, K227M, F80K, L232KPromoterLac and J23119Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Neg. Ctrl_sgRNA
Plasmid#111298PurposeCRISPR KO murine neg. ctrl.DepositorInsertNegCtrl sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pgRNAkan-glpR
Plasmid#169873PurposeSingle guide RNA plasmid for Cas9 targeting glpR in P. putidaDepositorInsertsgRNA towards glpR in Pseudomonas putida
UseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceJuly 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
TU6m-gRNAscaffHygroR
Plasmid#165485PurposeS. pyogenes Cas9 guide RNA expression in tilapia cellsDepositorTypeEmpty backboneUseCRISPRPromoterOreochromis mossambicus U6Available SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBzCas13b-gRNA-1
Plasmid#164858PurposeConstitutive expression of single-spacer CRISPR array with spacer #1 targeting deGFP mRNA for BzCas13b in bacteria.DepositorInsertBzCas13b-gRNA-1
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLsCas13a-gRNA-NT
Plasmid#164857PurposeConstitutive expression of single-spacer CRISPR array with non-targeting spacer for LsCas13a in bacteria.DepositorInsertLsCas13a-gRNA-NT
ExpressionBacterialPromoterJ23119Available SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-pgaC
Plasmid#154919PurposeaTc inducible gRNA targeting pgaC along with arabinose-inducible lambda red enzymesDepositorInsertgRNA targeting pgaC
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpTetAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBbdCas9S_P0526-sgRNAmreB
Plasmid#149654Purposeall-in-one CRISPRi vector for targeting B. burgdorferi mreBDepositorInsertdCas9, lacI, sgRNAmreB
UseCRISPRExpressionBacterialPromoterPflaB, PpQE30, P0526Available SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBSV2G_PflaBS-sgRNA500
Plasmid#149615PurposegRNA expression in B. burgdorferi, parental vectorDepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterPflaBSAvailable SinceOct. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA2
Plasmid#138186Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT2A sgRNA1
Plasmid#138185Purpose3rd generation lentiviral gRNA plasmid targeting human KAT2ADepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRRAP sgRNA3
Plasmid#138184Purpose3rd generation lentiviral gRNA plasmid targeting human TRRAPDepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEX-A-U6-MaSgRNA_PuroR
Plasmid#84780PurposeExpresses major satellite-specific sgRNA.DepositorInsertmajor satellite-specific sgRNA
UseCRISPRExpressionBacterial and MammalianPromoterU6Available SinceJuly 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA1
Plasmid#113130PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 1 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianPromoterU6 for gRNA expression, RSV for GFP expressionAvailable SinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBluescript_VEGFA-TS3_SaCas9_sgRNA2
Plasmid#107330PurposeU6 driven SaCas9 sgRNA expression for VEGFA site 3DepositorInsertVEGFA-TS3 sgRNA
UseCRISPRPromoterU6Available SinceNov. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
IL1RN gRNA3
Plasmid#113132PurposeExpresses gRNA targeting the IL1RN promoter (SpyCas9 scaffold)DepositorInsertIL1RN guideRNA 3 (SpCas9 scaffold), co-expressed GFP (transfection marker)
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
MYC sgRNA5
Plasmid#100557PurposeExpresses MYC sgRNA5. Target sequence GAGAGGCAGAGGGAGCGAGCDepositorInsertMYC sgRNA5
PromoterU6Available SinceSept. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rssA
Plasmid#89957PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rssA.DepositorInsertrssA gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-rpsL
Plasmid#89953PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting rpsL.DepositorInsertrpsL gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only