We narrowed to 16,346 results for: GRN
-
Plasmid#225986PurposeTo make Gateway entry clone of CRISPR guide RNA under AtU6pDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits
-
pcU6.3_gRNA_c1
Plasmid#221381PurposeChicken-specific U6 sgRNA expression mini-vector with 10x capture sequence 1DepositorTypeEmpty backboneUseCRISPRPromoterG. gallus U6.3Available SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
p184_LTJ_sgRNACD90.2
Plasmid#82670PurposesgRNA targeting murine CD90.2. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting mouse CD90.2
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
U6_sgRNA_CAG_hSt1Cas9_LMD9
Plasmid#110626PurposeA single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNA.DepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseCRISPR and Synthetic BiologyTagsSV40 NLSExpressionMammalianPromoterCAG and hU6Available SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TRIM25_G1
Plasmid#127119DepositorInsertgRNA TRIM25 (TRIM25 Human)
UseCRISPRAvailable SinceJuly 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T1
Plasmid#41821PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T1 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ZNF598
Plasmid#127121DepositorInsertgRNA ZNF598 (ZNF598 Human)
UseCRISPRAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA2_dTet_NGFR
Plasmid#189801PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA2 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA1_dTet_NGFR
Plasmid#189802PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA1 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
sgRNA1_ASCL1
Plasmid#64129PurposePhotoactivatable transcription system. Lentiviral expression of ASCL1 sgRNA1. Also contains a CMV-puro-t2A-mCherry expression cassette.DepositorAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_ATP1A1_G7_Dual_sgRNA
Plasmid#173206PurposeCoselection for HDR in human cells. Vector for dual expression of ATP1A1 G7 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G7 sgRNA + user-specified sgRNA + SpCas9
UseCRISPRExpressionMammalianPromoterDual U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCKO_LacZ_sgRNA
Plasmid#74179Purposelentiviral vector expressing sgRNA targeting LacZDepositorInsertLacZ sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6 PromoterAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNAH
Plasmid#63556PurposeExpresses gRNA in LeishmaniaDepositorInsertguide sequence
UseLeishmania expressionAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
Rosa26_gRNA
Plasmid#196138PurposegRNA targeting the Rosa26 locus in a thid generation Cas9 backbone with TagBFP2DepositorInsertRosa26 gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
gRNA_DNMT3a-T2
Plasmid#41822PurposeExpresses a guide RNA (gRNA) to target DNMT3a (T2 target sequence) for genome engineeringDepositorAvailable SinceJan. 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorInsertgRNA targeting ELAVL1 (ELAVL1 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
1x_a1gRNAOp_pCYC1m_yeBFP2
Plasmid#64390Purposeencodes one a1 operator site upstream of minimal pCYC1 promoter driving yeast enhanced BFPDepositorInsertyeast enhanced BFP2
ExpressionYeastAvailable SinceMay 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCBLsgRNA1
Plasmid#199727PurposeGolden Gate entry vector; 1st gRNA under OsU3 promoterDepositorInsertOsU3-sgRNA1 scaffold
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only