We narrowed to 5,559 results for: Chia
-
Plasmid#124226PurposeBacterial SpCas9-HF1 expressionDepositorInsertSpCas9-HF1
UseCRISPRTagsExpressionBacterialMutationPromoterTetR/TetAAvailable sinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK353
Plasmid#129697PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + terminator ECK120015170DepositorInsertsPrhaBAD
yfp
rhaS
Terminator ECK120015170
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCK355
Plasmid#129699PurposeFor insulated expression in Synechocystis 6803. As pCK306 (rhaBAD rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites) + ilvBN terminatorDepositorInsertsPrhaBAD
yfp
rhaS
ilvBN terminator
UseTagsExpressionBacterialMutationPromoterAvailable sinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET15b-GreBdm-D41N
Plasmid#129691Purposeexpress E. coli GreB E82C/C68S/D41NDepositorInsertGreB E82C C68S D41N (greB E. coli)
UseTagshis6ExpressionBacterialMutationPromoterAvailable sinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
pVR2
Plasmid#84719PurposeE. coli RecA promoter followed by stretch with no A's followed by riboswitch for single-round transcriptionDepositorInsertsE. coli RecA promoter
stretch lacking A's followed by 5' UTR of queC gene
UseTagsExpressionBacterialMutation12 nt stretch lacking A's inserted before 5&…PromoterAvailable sinceMarch 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
N229A Lo-MetQ
Plasmid#118268PurposeN229A Mutation in Methionine Binding Protein (MetQ) used to solve crystal structureDepositorInsertMetQ (N229A) (metQ E. coli)
UseTags10x His Tag and Enterokinase Cleavage SiteExpressionBacterialMutationChanged Asparagine (Asn) 229 to Alanine (Ala)PromoterT7 PromoterAvailable sinceJan. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
His8:MBP-tev-Ala-eK-Flv
Plasmid#83393Purposebacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studiesDepositorInsertflavin binding protein MioC
UseSynthetic BiologyTags3xHA, 8xHis, and MBPExpressionBacterialMutationPromoterAvailable sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
His8:MBP-tev-Ile-eK-Flv
Plasmid#83392Purposebacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studiesDepositorInsertflavin binding protein MioC
UseSynthetic BiologyTags3xHA, 8xHis, and MBPExpressionBacterialMutationPromoterAvailable sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
His8:MBP-tev-Tyr-eK-Flv
Plasmid#83391Purposebacterial expression vector pVP16 containing a derivative of E. coli lacZ fused with E. coli flavin binding protein MioC to be used in N-end rule in vitro ubiquitination studiesDepositorInsertflavin binding protein MioC
UseSynthetic BiologyTags3xHA, 8xHis, and MBPExpressionBacterialMutationPromoterAvailable sinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJOG250
Plasmid#80582Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, nptIIDepositorInsertspnos:nptII-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRTagsExpressionPlantMutationD10APromoterAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJOG251
Plasmid#80583Purposerecipient plasmid [multiplexing, activator]; p35S:Cas9 D10A/N863A-Hax3CT, BASTADepositorInsertspnos:PAT-tnos
p35S:Cas9 D10A/N863A-Hax3(CT)-t35S
BsaI-ccdB_CmR-BsaI
UseCRISPRTagsExpressionPlantMutationD10APromoterAvailable sinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pZS1[Iq:LacI-T]
Plasmid#60756PurposeContains PIq driving expression LacI-T, the Lactose inducible chimera with the TAN DBD.DepositorInsertLacI-T
UseSynthetic BiologyTagsExpressionBacterialMutationLacI without the tetramerization domain and the T…PromoterAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZS1[RbsR-T]
Plasmid#60751PurposeContains PIq driving expression RbsR-T, the Ribose inducible chimera with the TAN DBD.DepositorInsertRbsR-T
UseSynthetic BiologyTagsExpressionBacterialMutationChimeric LacI/GalR repressor with the TAN DBD and…PromoterAvailable sinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
pEGFP-N2-2XNLS-RNaseH1 delta 1-27 (WT)
Plasmid#196702PurposePlasmid for transient mammalian expression of wild type RNase H1 tagged with 2xNLS and EGFP that can be used to specifically degrade the nuclear R-loops.DepositorInserthuman RNaseH1 wild type
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET22b-T7-6h-GST-α-Synuclein
Plasmid#225224PurposeAlpha synuclein gene fused with gst gene under t7 promoter for bacterial expression of alpha synuclein protein.DepositorInsertsGST
α-Synuclein
UseTags6xHis Tag and TEV Cleavage SiteExpressionBacterialMutationPromoterT7Available sinceFeb. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA C12 ecDHFR DD YFP HA
Plasmid#192815PurposeExpresses an N-terminal enhanced destabilizing domain (DD) version of E. coli DHFR with higher basal turnover in mammalian systems. Contains missense mutations W74R/T113S/E120D/Q146L.DepositorInsertE. coli dihydrofolate reductase
UseTagsenhanced yellow fluorescent protein and hemagglut…ExpressionMammalianMutationW74R/T113S/E120D/Q146LPromoterCMVAvailable sinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPV-Dual_promoter-EF1α-2xNLS-Cascade+Cas3-P (RD)
Plasmid#204619PurposeExpression vector of Cascade and Cas3. Puromycin selectable.DepositorInsertCas7, Cas5, Cas8, Cas11, Cas6, and Cas3
UseCRISPRTagsEach protein has C- and N-terminal SV40 NLSExpressionMutationPromoterEF1aAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-CAG-hCas3
Plasmid#134920PurposeComponents for genome editing in mammalian cells with pCAG-All-in-one-hCascade and pBS-U6-crRNA-targeted.DepositorInsertCas3 with bpNLS
UseTagsExpressionMammalianMutationPromoterCAGAvailable sinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
RGB-S reporter
Plasmid#207841PurposeA three-colour stress biosensor for real time analysis of physiological stress, genotoxicity, and cytotoxicity of Escherichia coliDepositorInsertsRpoH sensing construct
SOS sensing construct
RpoS sensing construct
UseTagsExpressionBacterialMutationPromoterPosmY, PsulA, and grpEAvailable sinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-EcSTH-FLAG
Plasmid#218628PurposeThis plasmid contains human codon optimized sequence of EcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertEcSTH
UseLentiviral and Synthetic BiologyTagsFLAGExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-mitoEcSTH-FLAG
Plasmid#218629PurposeThis plasmid contains human codon optimized sequence of mitoEcSTH which is a soluble transhydrogenase from E. coli that can be used to increase NADH/NAD+ ratio in mammalian cells.DepositorInsertmitoEcSTH
UseLentiviral and Synthetic BiologyTagsFLAG and MTSExpressionMammalianMutationPromoterAvailable sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-BioID-FAM21
Plasmid#121046PurposeExpresses GFP tagged BioID and human FAM21C in mammalian cellsDepositorInsertsUseTagsGFPExpressionMammalianMutationR118G (highly promiscuous form)PromoterCMVAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1-recA56
Plasmid#89962PurposeModified from pEM-Cas9HF1 (Addgene ID: 89961) to include constitutive recA56 to block recA-mediated double-strand break repair.DepositorInsertsCas9HF1
recA56
UseTagsExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTet and proDAvailable sinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC1_oROS-HT
Plasmid#216413PurposeExpresses the genetically encoded, chemigenetic hydrogen peroxide sensor oROS-HT in mamalian cells.DepositorInsertoROS-HT
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceJune 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pARC8-LambdaRedBeta-EcSSB
Plasmid#162572PurposeArabinose inducible recombineering plasmid encoding Lambda-Red Beta with EcSSB for use with dsDNA templates and enhanced recombination efficiency.DepositorInsertsLambda Red-Beta
E. coli SSB
UseTagsExpressionBacterialMutationPromoterpBADAvailable sinceMay 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPB1163
Plasmid#210032PurposeContains Cas3 gRNA cloning site, inducible Cas11-P2A-Cas6-T2A-Cas3, rtTA-T2A-blastDepositorInsertsCas11-P2A-Cas6-T2A-Cas3
rtta-T2A-blast
UseCRISPRTagsSV40 NLSExpressionMammalianMutationPromoterEF-1α and TRE3GAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_Thy1StTA
Plasmid#97411PurposeTET driver for amplified expression in cortical neuronsDepositorInserttTA
UseAAVTagsExpressionMammalianMutationPromotermouse thy1PSsAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
miniABEmax (pRZ900)
Plasmid#131311PurposeCMV promoter expression plasmid for bpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS (ABEmax with truncation of WT TadA domain).DepositorInsertbpNLS-TadA7.10-32AA linker-hSpCas9n(D10A)-bpNLS-P2A-EGFP-NLS
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceSept. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-PTuner DD-M.EcoGII-v5-Telomeric repeat-binding-factor1
Plasmid#122084PurposeExpress M.EcoGII fused to TRF1 with detabilization domain - inducibleDepositorInsertDD-linker-M.EcoGII-V5-TERF1
UseRetroviralTagsV5 tag on Nter of TERF1ExpressionBacterial and MammalianMutationPromoterAvailable sinceMay 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-nt
Plasmid#195343PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed nonsense non-targeting gRNADepositorInsertsecTadA(8e)-SpCas9-NG
gRNA gtgcacgacgccgtatgcga
UseCRISPRTagsExpressionMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable sinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HisMBP-SED1
Plasmid#178191PurposeSED1 biosensor for expression in Escherichia coliDepositorInsertSED1 biosensor
UseTags6xHis-MBPExpressionBacterialMutationPromotertacAvailable sinceDec. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMM643
Plasmid#112533PurposepZE2-PLhrtO-lux-hrtR-RBS3-chuA - HrtR RBS variant of plasmid pMM627 (Strength 33545.5 AU), ColE1 origin, KanRDepositorInsertsHrtR
ChuA
luxCDABE
UseTagsExpressionBacterialMutationA17PPromoterJ23107, PL(HrtO), and ProDAvailable sinceFeb. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
UseTags6XHis, EGFP, and FlagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
p-spTorA-GFP-H6C
Plasmid#168517PurposeGFP with the signal peptide of TorA (spTorA) in pBAD24. Includes a C-terminal HHHHHHC (6xHisC) extension.DepositorInsertspTorA-GFP-H6C
UseTags6xHisC tag and spTorA (signal peptide of E. coli …ExpressionBacterialMutationThe mut3 GFP variant with 5 additional mutations …PromoteraraBADAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPing
Plasmid#47100PurposeExpresses the Ping open reading frame 1 (ORF1) and transposase from rice to allow mPing movement. The vector contains ORF1, transposase, mPing element and hph for hygromycin selection.DepositorInsertsPing cDNA
mPing
hygromycin resistance gene
UsePlant expressionTagsGFPExpressionYeastMutationPromoterCaMV35s and StUbi3Available sinceSept. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCAT-YFP-TetR
Plasmid#59018PurposeExpresses a fusion of yellow fluorescent protein (YFP) to the N-terminus of the Escherichia coli Tn10 tet repressor (TetR) driven by the alpha tubulin promoter for use in T. gondiiDepositorInsertYFP-TetR
UseToxoplasma expressionTagsExpressionMutationPromoteralpha-tubulinAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
ScSpe1 pET-20b(+)
Plasmid#117145PurposeExpresses the His tagged Saccharomyces cerevisiae Ornithine Decarboxylase in Escherichia coli BL21DepositorInsertSPE1
UseTagsHistidineExpressionBacterialMutationPromoterT7Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK301
Plasmid#87767PurposeE. coli rhaBAD promoter upstream of sfGFP, sfGFP can be replaced with any gene of interest to express using L-rhamnose, three terminators, ampR, pBR322 origin, lacIDepositorInsertPrhaBAD-sfGFP
UseSynthetic BiologyTags6xHis TagExpressionBacterialMutationPromoterPrhaBAD rhamnose-inducible promoter from E. coliAvailable sinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHS0766 pET45b(+) His14-MBP-TEV-AloTnpB-2 3' extension
Plasmid#176542PurposeBacterial expression of His14-MBP-TEV-AloTnpB-2 with 3' extension derived from locusDepositorInsertsMBP tag
TnpB
UseTags3' extension derived from endogenous locus a…ExpressionBacterialMutationPromoterAvailable sinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAd5-Blue
Plasmid#174431PurposepAd5-Blue provides a platform for the rapid construction of recombinant and replication defective Adenovirus. This vector contains unique restriction enzyme sites to allow cloning of a gene.DepositorInsertβ-galactosidase α gene fragment
UseAdenoviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceMay 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pICSL11055
Plasmid#68252PurposeLevel 1 Golden Gate Cassette: Plant kanamycin resistance cassetteDepositorInsertPromoter:2x35s+5'UTR:Omega+CDS:nptII+3'UTR/terminator:Nos
UseSynthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceSept. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCK314
Plasmid#110545PurposeModified (delta CRP-binding site) rhamnose-inducible promoter, YFP, an E. coli-Synechocystis shuttle vector, chromosomal-integration sites. Allows precise & sustained gene expression in cyanobacteriaDepositorInsertsModified PrhaBAD (CRP-binding sites removed)
yfp
rhaS
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-FLAG-LplA(AAG)
Plasmid#61307PurposeContains FLAG epitope for immunofluorescence detection of resorufin ligase for mammalian cell expressionDepositorInsertE. coli lipoic acid ligase
UseTags6xHis, Flag, T7 tag, and Xpress epitopeExpressionMammalianMutationE20A, F147A, H149GPromoterCMVAvailable sinceMarch 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIBN-TetR
Plasmid#103813PurposeBLInCR 'Localizer' construct that marks tetO arrays and is targeted by a PHR-tagged effector upon illumination with blue lightDepositorUseTagsExpressionMammalianMutationTetR: A4G (M2V)PromoterCMVAvailable sinceJan. 9, 2018AvailabilityAcademic Institutions and Nonprofits only