We narrowed to 8,573 results for: reporter
-
Plasmid#191023Purposeflp-18 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pSJ1568 (pRS315-NOP1pr-GFP11-mCherry-SCS2TM)
Plasmid#86416PurposeONM/ER split GFP11 reporter with mCherryDepositorInsertNOP1pr-GFP11-mCherry-Scs2TM
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGH00.0126
Plasmid#64257PurposeBinary T-DNA vector expressing EGFP and neomycin phosphotransferase II (NPTII); for Agrobacterium tumefaciens-mediated transformationDepositorInsertsEGFP
neomycin phosphotransferase II
UseBinary agrobacterium vector for plant transformat…ExpressionPlantPromoterE12-omegaAvailable SinceJune 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
KA1396_pGL4-UBCmin-luc2/Klf4-E'
Plasmid#124187PurposeLuciferase reporter driven by the Klf4 enhancerDepositorInsertKlf4 enhancer
UseLuciferasePromoterUBCminAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-NLS-CBGreen-FIRE-puro
Plasmid#139195PurposeLuminescent reporter of ERK activityDepositorInsertCBG99
UseLuciferase and RetroviralTagsFra1 PEST domain fragment (FIRE) and nuclear loca…ExpressionMammalianMutationSee depositor comments belowAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-EGFP-Bulged-miR-19
Plasmid#91976PurposeEGFP reporter cell line with eight bulged miR-19 sitesDepositorInsertEGFP
UseRetroviralExpressionMammalianAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
KA2626_pGL4-UBCmin-luc2/Klf2-D'
Plasmid#124199PurposeLuciferase reporter driven by the Klf2 enhancerDepositorInsertKlf2 enhancer
UseLuciferasePromoterUBCminAvailable SinceApril 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA1401_pGL4-UBCmin-luc2/Klf4-F'
Plasmid#124188PurposeLuciferase reporter driven by the Klf4 enhancerDepositorInsertKlf4 enhancer
UseLuciferasePromoterUBCminAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
KA1395_pGL4-UBCmin-luc2/Klf4-B'
Plasmid#124186PurposeLuciferase reporter driven by the Klf4 enhancerDepositorInsertKlf4 enhancer
UseLuciferasePromoterUBCminAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
TC1154
Plasmid#164876PurposeSplit GFP reporter plasmid expressing GFP (b11betaDepositorInsertSplit GFP(beta11)
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
TC1541A
Plasmid#164875PurposeSplit GFP reporter expressing GFP(beta1-10) following C>U editing of the target siteDepositorInsertSplit GFP(beta1-10)
ExpressionMammalianAvailable SinceMarch 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSJ1602 (pRS315-NOP1pr-mCherry-SCS2TM-GFP11)
Plasmid#86417Purposeluminal split GFP11 reporter with mCherryDepositorInsertNOP1pr-mCherry-SCS2TM-GFP11
TagsGFP11 and mCherryExpressionYeastPromoterNOP1Available SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1092-luc2
Plasmid#227112PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1092DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1092 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
OA984-HA
Plasmid#120362PurposeExpresses a his-tagged single chain antibody 1C19 that targets all four DENV serotypes and expresses red fluorescent protein reporterDepositorInsert1C19 his-tagged single chain antibody
UseUnspecifiedPromoterAAEL010782 carboxypeptidase A (CPA) gene PromoterAvailable SinceFeb. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Renilla luciferase-Pol III
Plasmid#37380DepositorInsertPolIII-Renilla control reporter (RpIII128 Fly)
UseLuciferaseExpressionMammalianPromoterRNA PolIII 128 subunit (RpIII128)Available SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGL4_NFAT-RE-CMVmin-BC0524-luc2
Plasmid#227139PurposeBarcoded assay, Ca2+ sensor; barcode BC0524DepositorInsert6x clustered NFAT element linked to CMV minimal promoter driving barcode 0524 and a luciferase reporter gene
ExpressionMammalianAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pmiRGLO Dual-Luciferase-MYB-3'UTR
Plasmid#182250PurposeHuman MYB 3` UTR region containing 3x binding sites for miR-150 cloned downstream of luciferase reporter geneDepositorInsert3' UTR region of MYB gene
UseLuciferaseExpressionMammalianAvailable SinceMarch 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSNRW-Z5-Nluc
Plasmid#174487PurposeRecombinant fusion protein gene combining IgG-Fc binding domain Z (5 repeats) of Staphylococcal Protein A and bioluminescence reporter Nanoluciferase in pET28a bacterial expression plasmid.DepositorInsertZ5-Nluc
Tags6x Histidine tag (N terminal on insert)ExpressionBacterialPromoterT7lac promoterAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPS0381
Plasmid#133231PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter PsNifH (pOGG043), sfGFP (pOGG037) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-DIO-IGK-dAPEX2-KDEL
Plasmid#117183PurposePlasmid name in publication: pAAV-DIO-ER-dAPEX2. Peroxidase reporter for multiplexed electron microscopy labelingDepositorInsertIGK-dAPEX2-KDEL
UseAAV and Cre/LoxExpressionMammalianMutationW41F and A134P on soybean APXPromoterEF1aAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHPHS853
Plasmid#228236PurposeBxb1 attB_GA mCherry-T2A-puro, Dox-inducible EYFP reporter for integration into Bxb1 attP_GA landing padDepositorInsertsmCherry
EYFP
TagsHA and PuroRExpressionMammalianPromoterTRE3GV and noneAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-MLC2(CA)-IRES-GFP
Plasmid#133928PurposeBicistronic vector for the expression of EGFP reporter and untagged constitutive active myosin II light chainDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCIneoRL-BCL2 3'UTR
Plasmid#84597PurposeRenilla luciferase reporter containing BCL2 3' UTRDepositorAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMTS-hFluc-HA-GFP11
Plasmid#177726PurposeFirefly luciferase reporter fused to a mitochondria signal sequence for mitochondrial targeting with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, and Mitochondrial Targeting SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-ITGA6-1k-Basic-LUC
Plasmid#107141PurposeLuciferase reporter plasmid to monitor transcriptional activity of canine ITGA6-promoter (1kb fragment)DepositorInsertITGA6-promoter
UseLuciferaseExpressionMammalianAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
LEPZ
Plasmid#111161PurposemiR-E (miR-30 variant)-based RNAi with ZsGreen reporterDepositorInsertmiR-E (miR-30 variant)
UseRetroviralMutationWTAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPS0382
Plasmid#133232PurposeReporter plasmid for R. leguminosarum suitable for experiments in environments where there is no antibiotic selection present.DepositorInsertconstructed with constitutive promoter PsNifH (pOGG043), mCherry (EC15071) and T-pharma (pOGG003)
ExpressionBacterialMutationDomesticated for Golden Gate cloningAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
12x PRE TK luc
Plasmid#206163PurposeLuciferase reporter construct containing 12 consensus PGR binding sites upstream of a minimal TK promoter, derived from Addgene #11350DepositorInsert12X PRE TK luciferase
UseLuciferaseExpressionMammalianPromotermin TKAvailable SinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRAB18-GFP
Plasmid#106984PurposeABA signaling reporter, GFP under the RAB18 promoterDepositorInsertsGFP
ExpressionPlantPromoterRAB18Available SinceJune 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCambia2300 - ProRUBY:RUBY-Citrine
Plasmid#128796PurposeFluorescent reporter for subcellular localisation and expression analysis of RUBYDepositorInsertRUBY PARTICLES IN MUCILAGE (AT1G19900 Mustard Weed)
TagsCitrineExpressionPlantPromoterProRUBYAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
TNF-SBP-EGFP_puromycin
Plasmid#65284PurposeTNF reporter only (no hook) (RUSH system)DepositorInsertTNF (TNF Human)
TagsEGFP and Streptavidin Binding Protein (SBP)ExpressionMammalianPromoterCMVAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-mCherry-Venus-NLS-D2
Plasmid#110058PurposePer2 transcription fluorescence reporterDepositorInsertPer2 promoter and mCherry and Venus (Per2 Mouse)
UseAAV and Cre/LoxTagsNLS-D2ExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAG397
Plasmid#226733PurposeExpresses a reporter for an alpha-helical OMM proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-DDdCas9VP192-T2A-GFP-IRES-Neo
Plasmid#102885PurposePiggyBac transposon system construct with constitutive CAG promoter expression of TMP inducible DDdCas9VP192 activator followed by T2A-EGFP as a reporter and IRES-Neo as selectionDepositorInsertDDdCas9VP192-T2A-GFP-IRES-Neo
UseCRISPRExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human NANOS3-P2A-mCherry knock-in targeting construct
Plasmid#59721PurposeGene targeting construct for human NANOS3 locus, introducing a P2A-mCherry reporter gene. Contains an frt-PGK-Neo-PA-frt cassette that can be excised.DepositorInsertP2A mCherry
ExpressionMammalianAvailable SinceDec. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
PP023 - CAG::QuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
Plasmid#182063PurposeCo-expression of Arch-based voltage indicator (QuasAr6a) and membrane-localized calcium reporter (jRGECO1a-CAAX)DepositorInsertQuasAr6a-TS-dmCitrine-TSx3-ER2-p2a- jRGECO1a-CAAX
UseLentiviralPromoterCAGAvailable SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Camk2a
Plasmid#186818PurposeFluorescent reporter for Camk2a expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Camk2b
Plasmid#186819PurposeFluorescent reporter for Camk2b expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGl3-Camk2g
Plasmid#186821PurposeFluorescent reporter for Camk2g expressionDepositorAvailable SinceApril 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
ACE2(-252)-luc
Plasmid#31111PurposeLuciferase reporter construct for human ACE2 promoterDepositorInsertACE2 promoter (ACE2 Human)
UseLuciferaseExpressionMammalianMutationpromoter region -252 to +103Available SinceOct. 14, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
BII-Sh-FUCCI-Luc
Plasmid#133364PurposePiggybac vector for shRNA-mediated knockdown, co-expressed with FUCCI cell cycle reporterDepositorInsertClover-Geminin-IRES-mKO2-Cdt1
TagsHA-tagged Clover-GemininExpressionMammalianMutationN/APromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
ErbB-3-pGL3
Plasmid#60899Purposehuman ErbB-3 promoter reporter constructDepositorAvailable SinceNov. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV 5TOP intron renilla TRICK CTE polyA
Plasmid#64544Purpose5′ TOP TRICK reporter mRNADepositorInsert12x PP7 stem-loops
Tags24xMS2 stem loops, 5' TOP (5′ terminal oligo…ExpressionMammalianPromoterTetracycline-inducible promoter and 5′ UTR of hum…Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEY43
Plasmid#191047Purposeeat-4(prom6-1) fluorescent neural reporter driving nuclear mNeptune2.5 expression (refer to NeuroPAL paper for expression)DepositorAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDendra2-5'UTR(GAPDH)-Dendra2-3'UTR(GAPDH)
Plasmid#182368PurposeDendra2-based translation reporterDepositorInsertglyceraldehyde-3-phosphate dehydrogenase (Gapdh Mouse)
TagsPal-Dendra2ExpressionMammalianPromoterCMV promoterAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIL6-Nluc-hbb
Plasmid#239843PurposeTemplate for in vitro transcription of secreted nanoluciferase, with interleukin 6 signal peptide, flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertSecreted nanoluciferase, with interleukin 6 signal peptide, flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4_CRE-CMVmin-BC0491-luc2
Plasmid#227133PurposeBarcoded assay, cAMP/Ca2+ sensor; barcode BC0491DepositorInsert6x clustered CRE element linked to CMV minimal promoter driving barcode 0491 and a luciferase reporter gene
ExpressionMammalianAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
LSM081 SFFV-mCherry-SGc(stem-1(3xMS2)2-stops)cSG-EGFP (FLP-IN)
Plasmid#233440PurposeSFFV driven LIDAR reporter with an additional stop codon on the stem loopDepositorInsertSGc(stem-1(3xMS2)2-stops)cSG-EGFP
ExpressionMammalianMutationWTPromoterSFFVAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only