-
Plasmid#87400PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1414a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
tRNA-gRNA position [M1_2] (GB1209)
Plasmid#75410PurposetRNA and scaffold for the assembly of GBoligomers for the first position (positon [M1_2]) of a polycistronic tRNA-gRNA regulated by the (monocot) U3 promoter (3-part multiplexing)DepositorInserttRNA-gRNA position [M1_2]
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable sinceAug. 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUAST-HA, Pbl-A C-Term
Plasmid#69795PurposePebble isoform A, C-Term, in P element-based pUAST vector for Gal4-regulated expression in Drosophila.DepositorInsertPebble C-Term domain (Drosophila guanine nucleotide exchange factor)
UseP element-based puast vector for gal4-regulated e…TagsHA-TagExpressionInsectMutationJust the C-Term domain of Pebble (pbl)Promoterhsp70 promoterAvailable sinceOct. 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C820S (NT573)
Plasmid#49075PurposeExpresses human NKCC1 C820S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC820S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C1052S (NT674)
Plasmid#49076PurposeExpresses human NKCC1 C1052S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC1052S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C791S (NT572)
Plasmid#49074PurposeExpresses human NKCC1 C791S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC791S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 intracellular-cysteineless (NT855)
Plasmid#49080PurposeExpresses human NKCC1 mutant lacking cysteine residues within intracellular loops and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC791S, C820S, C1052S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 ECL4 deletion (NT865)
Plasmid#49070PurposeExpresses human NKCC1 truncation mutant lacking extracellular loop #4 (aa562-582) and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationECL4 deletion of amino acids 562-582 in hNKCC1 in…PromoterCMVAvailable sinceNov. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C543M (NT360)
Plasmid#49068PurposeExpresses human NKCC1 C543M mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC543M in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C723S,C724V (NT501)
Plasmid#49073PurposeExpresses human NKCC1 C723S and C724V mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC723S,C724V in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630S (NT400)
Plasmid#49072PurposeExpresses human NKCC1 C630S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC630S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C630A (NT399)
Plasmid#49071PurposeExpresses human NKCC1 C630A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC630A in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 cysteineless (NT868)
Plasmid#49079PurposeExpresses human NKCC1 mutant lacking cysteine residues and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C563S,C568S,C577S,C582S, C630S, C72…PromoterCMVAvailable sinceNov. 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 TM-cysteineless (NT859)
Plasmid#49078PurposeExpresses human NKCC1 mutant lacking cysteine residues within transmembrane domains and with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic,containing convenient restriction sitesDepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC295A, C543M, C630S, C723S, C724V in hNKCC1 in NT…PromoterCMVAvailable sinceNov. 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C295A (NT104)
Plasmid#49067PurposeExpresses human NKCC1 C295A mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC295A in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Flag YFP hNKCC1 C295S (NT103)
Plasmid#49066PurposeExpresses human NKCC1 C295S mutant with an N-terminal 3xFLAG-YFP tag in mammalian cells. cDNA is synthetic, containing convenient restriction sites.DepositorInserthuman NKCC1 (synthetic) (SLC12A2 Synthetic, Human)
UseTags3x Flag and mVenusExpressionMammalianMutationC295S in hNKCC1 in NT17PromoterCMVAvailable sinceNov. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
SNX1-PX (142-269)
Plasmid#119082PurposeBacterial expression of human phox homology (PX) domain, SNX1-PX (142-269)DepositorInsertSNX1-PX (142-269) (SNX1 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX2-PX (136-279)
Plasmid#119083PurposeBacterial expression of human phox homology (PX) domain, SNX2-PX (136-279)DepositorInsertSNX2-PX (136-279) (SNX2 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX8-PX (70-190)
Plasmid#119089PurposeBacterial expression of human phox homology (PX) domain, SNX8-PX (70-190)DepositorInsertSNX8-PX (70-190) (SNX7 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX9-PX (246-376)
Plasmid#119090PurposeBacterial expression of human phox homology (PX) domain, SNX9-PX (246-376)DepositorInsertSNX9-PX (246-376) (SNX9 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX15-PX (1-127)
Plasmid#119096PurposeBacterial expression of human phox homology (PX) domain, SNX15-PX (1-127)DepositorInsertSNX15-PX (1-127) (SNX15 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX23-PX (1178-1312)
Plasmid#119102PurposeBacterial expression of human phox homology (PX) domain, SNX23-PX (1178-1312)DepositorInsertSNX23-PX (1178-1312)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX24-PX (1-101)
Plasmid#119103PurposeBacterial expression of human phox homology (PX) domain, SNX24-PX (1-101)DepositorInsertSNX24-PX (1-101) (SNX24 Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX26-PX (56-172)
Plasmid#119105PurposeBacterial expression of human phox homology (PX) domain, SNX26-PX (56-172)DepositorInsertSNX26-PX (56-172)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX28-PX (1-124)
Plasmid#119107PurposeBacterial expression of human phox homology (PX) domain, SNX28-PX (1-124)DepositorInsertSNX28-PX (1-124)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
SNX34-PX (1-130)
Plasmid#119113PurposeBacterial expression of human phox homology (PX) domain, SNX34-PX (1-130)DepositorInsertSNX34-PX (1-130)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
PXK-PX (1-125)
Plasmid#119114PurposeBacterial expression of human phox homology (PX) domain, PXK-PX (1-125)DepositorInsertPXK-PX (1-125) (PXK Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
IRAS-PX (13-124)
Plasmid#119118PurposeBacterial expression of human phox homology (PX) domain, IRAS-PX (13-124)DepositorInsertIRAS-PX (13-124)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
PI3KC2beta-PX (1348-1487)
Plasmid#119120PurposeBacterial expression of human phox homology (PX) domain, PI3KC2beta-PX (1348-1487)DepositorInsertPI3KC2beta-PX (1348-1487) (PIK3C2B Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
PI3KC2gamma-PX (1200-1310)
Plasmid#119121PurposeBacterial expression of human phox homology (PX) domain, PI3KC2gamma-PX (1200-1310)DepositorInsertPI3KC2gamma-PX (1200-1310) (PIK3C2G Human)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
RICS-PX (127-255)
Plasmid#119126PurposeBacterial expression of human phox homology (PX) domain, RICS-PX (127-255)DepositorInsertRICS-PX (127-255)
UseTagsGSTExpressionBacterialMutationPromotertacAvailable sinceAvailabilityAcademic Institutions and Nonprofits only -
pHyperTEV60
Plasmid#228496Purpose10xHis-SUMO (Smt3) tagged HyperTEV60 engineered protease (E. coli based protein expression)DepositorInsertTEV Protease
UseTags10xHis-SUMO(Smt3)ExpressionBacterialMutationPromoterT7 PromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
lis-1::L4440
Plasmid#11336DepositorInsertlis-1 (lis-1 Nematode)
UseRNAiTagsExpressionWormMutationPromoterAvailable sinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUC-L3L2
Plasmid#114019PurposeCreate Entry clones for Gateway LR reactions through simple restriction enzyme based cloningDepositorInsertccdB gene, Chloramphenicol resistance gene
UseGatewayTagsExpressionMutationPromoterAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC-L1L4
Plasmid#114018PurposeCreate Entry clones for Gateway LR reactions through simple restriction enzyme based cloningDepositorInsertccdB gene, Chloramphenicol resistance gene
UseGatewayTagsExpressionMutationPromoterAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
nud-1::L4440
Plasmid#11337DepositorInsertnud-1 (nud-1 Nematode)
UseRNAiTagsExpressionWormMutationPromoterAvailable sinceJuly 12, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUC-L1L2
Plasmid#114017PurposeCreate Entry clones for Gateway LR reactions through simple restriction enzyme based cloningDepositorInsertccdB gene, Chloramphenicol resistance gene
UseGatewayTagsExpressionMutationPromoterAvailable sinceJan. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
MZB186
Plasmid#228489PurposeEmpty 10xHis-SUMO (Smt3) fused Avi-tag vector for rapid cloning/DNA assembly via SwaI restriction site for E. coli based protein expressionDepositorTypeEmpty backboneUseTags10xHis-SUMO(Smt3)-AvitagExpressionBacterialMutationPromoterT7 PromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJG01
Plasmid#213505Purposeexpresses TdTomato in Capsaspora owczarzakiDepositorInsertTdTomato
UseTagsExpressionMutationPromoterEF1Available sinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorTagsExpressionMammalianMutationPromoterTRE+CMVmin promoterAvailable sinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLS-SV40-mP-Rluc
Plasmid#106292PurposeLuciferase lentivirus based enhancer assay vectorDepositorInsertLuciferase
UseLentiviral and LuciferaseTagsExpressionMutationPromoterDerived from pGL4.23Available sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINN-GFP
Plasmid#53541PurposepTirex based GFP fusion vector for expression in mammalian, E. coli and insect cells using the baculovirus systemDepositorInsertGFP
UseTagsN-His-GFPExpressionBacterial, Insect, and Mamm…MutationPromoterAvailable sinceJune 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-SRM (sortase recognition motif)-hphMX4
Plasmid#54488PurposePCR based C-terminal SRM tagging in yeastDepositorInsertSRM (sortase-recognition motif)
UseYeast genome targetingTagshphMX4ExpressionMutationPromoterAvailable sinceAug. 28, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBIR-GFP
Plasmid#49807PurposeIn vivo GFP based system to measure break induced replication (BIR) repair efficiency. expression of I-SceI generates a double strand break that when repaired by BIR mechanism will restore GFP.DepositorInsertGFP
UseTagsExpressionMammalianMutationPromoterbeta-actinAvailable sinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti-dsRed
Plasmid#201999PurposeBased on CROP-seq-opti (addgene #106280), we replaced the PURO resistance gene with a dsRed.DepositorTypeEmpty backboneUseCRISPR and LentiviralTagsdsRedExpressionMammalianMutationPromoterEF1aAvailable sinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
MZB211
Plasmid#228494Purpose10xHis-SUMO (Smt3) tagged Ssod7-fused Pfu Polymerase with fidelity enhancing mutation (E. coli based protein expression)DepositorInsertpol
UseTags10xHis-SUMO(Smt3)ExpressionBacterialMutationA408SPromoterT7 PromoterAvailable sinceJan. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
Col2a1:TFPnls-mErt-Cre-Ert
Plasmid#111152PurposeChondrocyte specific inducible CreDepositorInsertTFPnls-T2a-mErt-Cre-Ert
UseCre/LoxTagsExpressionMutationwtPromoterAvailable sinceJuly 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNIC28-Bsa4-TF
Plasmid#61689PurposeE. coli expression vector based on pNIC28-Bsa4 (addgene #26103) with the TEE and trigger factor sequences insertedDepositorTypeEmpty backboneUseTagsHIS and Trigger FactorExpressionBacterialMutationPromoterT7Available sinceMarch 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pC23-LIC-STREP
Plasmid#182507PurposepET based vector for protein expression in E.coli for targets fused with C-terminal STREPDepositorTypeEmpty backboneUseTagsTEV-STREPExpressionBacterialMutationPromoterT7Available sinceMay 9, 2022AvailabilityAcademic Institutions and Nonprofits only