We narrowed to 6,995 results for: tet
-
Plasmid#213031PurposeBi-directional luciferase antisense intron (firefly fluc AI) human LINE-1 retrotransposition reporter (ORFeus-Hs sequence) for sleeping beauty integrationDepositorInsertTet-On Human LINE-1 (ORFeus-Hs) Firefly + Renilla Luciferase Antisense Intron dual retrotransposition marker
UseLuciferaseTagsFirefly luciferase antisense intron (3' UTR)ExpressionMammalianPromoterpTRE bidirectional tet-onAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-NB
Plasmid#197092PurposePiggyBac plasmid with tet-inducible expression of transcription factors for sensory neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
EF1a-hP53DD (TET+CTD)
Plasmid#214082PurposeMammalian expression tetramerization domain (TET) and C-terminal negative regulatory domain (CTD) of human TP53DepositorAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-FLEX-[FGL-2A-palmRFP1]
Plasmid#190236PurposeAAV vector, high-level expression of somatodendritic-targeted EGFP (FGL) and membrane-targted mRFP1 (palmRFP1) in neuronal cells in the presence of Cre recombinaseDepositorInsertEGFP
UseAAVTagsF2A, LDLR C-terminal sequence, mRFP1, myristoylat…ExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
epB_CAG_TetRFlag-nls-GFPx2_DEx2
Plasmid#119910PurposeePiggyBac mammalian expression plasmid for TetR-GFP fusionDepositorInsertTetRFlag-nls-GFPx2
ExpressionMammalianAvailable SinceMarch 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLIX403-hNOS2
Plasmid#110800Purposetet-inducible NOS2 expressionDepositorAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
Exp-Rosa-EF1a-tTA-mCh-Rs1-TetO(sh)-2
Plasmid#24419PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Expresses mCherry and Rs1 via P2A ribosomal skip sequence. Expresses tTA under EF1α promoter. Rosa26 homology arms for integration.DepositorInsertsUseMouse TargetingTagsFLAG and mCherry-P2AMutationD100APromoterEF1α and TRE, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pINIT_tet
Plasmid#46974PurposeFX sequencing vector for subcloning, tetracycline markerDepositorTypeEmpty backboneUseSequencing vectorPromoternoneAvailable SinceJan. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBItetDMPKSGFP
Plasmid#96903Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 0 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 0 CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKF-D2irTNP2AG-T2APuroR-5kwh
Plasmid#128255PurposeMammalian linearizer gene circuit based on negative feedback in a Flp-In expression system controlling the PuroR gene.DepositorInserthTetR::P2A::EGFP::T2A::PuroR
UseSynthetic Biology; Flp-in expression vectorExpressionMammalianPromoterCMV-D2ir promoterAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Ets2
Plasmid#70272PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine Ets2DepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-SynTetOff-myrGFP
Plasmid#190233PurposeAAV vector, high-level expression of EGFP with a myristoylation/palmitoylation signal derived from Fyn N-terminus (myrGFP) in neuronal cellsDepositorInsertEGFP
UseAAVTagsmyristoylation signal sequenceExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEnt R3L2 TetO(sh) mCh-Rs1-2
Plasmid#24417PurposeHuman 5HT4B receptor with D100A mutation, generating the RASSL Rs1. Construct expresses both mCherry and Rs1 via a P2A ribosomal skip sequence. Plasmid also known as pEntR3L2 TetO-mCh-Rs1.DepositorInsertRs1
UseGateway CloningTagsFLAG and mCherry-P2AMutationD100APromotershort TetO, miniCMVAvailable SinceMarch 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
P20_992-tetO-deGFP
Plasmid#97096PurposeExpresses GFP in the presence of Pseudomonas fluorescence sigma factor ECF20_992. Repressed by TetRDepositorInsertdeGFP
ExpressionBacterialPromoterP20_992 with TetO operator siteAvailable SinceMarch 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
T7-TetO-QF_T7-LacO-TetR_p15A
Plasmid#171659PurposeExpresses QF and/or TetR in BL21(DE3) E. coli according to the presence of aTc. Contains a p15A origin of replication.DepositorInsertT7-LacO-TetR-T7 Stop
ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA3288
Plasmid#46885PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted Wild Type human Uracil-N-glycosylaseDepositorInsertUracil-N-glycosylase WT (UNG Human)
UseLentiviralTagsMycExpressionMammalianPromoterTRE-TightAvailable SinceNov. 25, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV TRE3G Neo GFP-Lamin A wildtype
Plasmid#118709PurposeLentiviral TET-ON inducible GFP-Lamin A wildtypeDepositorInsertGFP-Lamin A human wildtype (LMNA Human)
UseLentiviral; Tet-on inducibleTagsGFPExpressionMammalianPromoterCMV TRE3G (TET-ON)Available SinceNov. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pT2-CMV/TetO2-EYFP-GW
Plasmid#153309PurposeTet-On YFP-tagged Gateway destination vector, to be used together with pT2-TetR-neoR transposon plasmidDepositorTypeEmpty backboneUseTransposonTagsYellow Fluorescent ProteinAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMA3287
Plasmid#46883PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted Y147A mutant human Uracil-N-glycosylaseDepositorInsertUracil-N-glycosylase, Y147A mutant (UNG Human)
UseLentiviralTagsMycExpressionMammalianMutationY147APromoterTRE-TightAvailable SinceAug. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAB303-Tier1-PhCMV-TetR_VPR
Plasmid#169575PurposeTier-1 vector encoding PhCMV-driven tetracycline-dependent VPR-based transactiavtor (PhCMV-TetR-VPR-pA).DepositorInserttetracycline-controlled transactivator
ExpressionMammalianPromoterPhCMVAvailable SinceJuly 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_AB
Plasmid#66008PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [A:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_EB
Plasmid#66009PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [E:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_FB
Plasmid#66010PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [F:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
R0040 (pTet)_GB
Plasmid#66011PurposeMoClo Basic Part: Controllable promoter - pTet - tetR regulated (strong constitutive promoter repressed by tetR, C0040, which can itself be inhibited by tetracycline or aTc) [G:R0040:B]DepositorInsertControllable promoter
UseSynthetic BiologyAvailable SinceJan. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHL1670
Plasmid#37634DepositorInsertsUseSynthetic BiologyTagsASV degradation tag and glgC leader regionExpressionBacterialPromoterpConM12NoHind and pConNoHindAvailable SinceAug. 14, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHL1668
Plasmid#37633DepositorInsertsUseSynthetic BiologyTagsASV degradation tag and glgC leader regionExpressionBacterialPromoterpConM12NoHind and pConNoHindAvailable SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRPF185
Plasmid#106367PurposeC. difficile inducible expression system. Shuttle plasmid containing a tetracycline-inducible gusADepositorInsertTerm(fdx)-Ptet-gusA-Term(slpA) (gusA )
UseE. coli - c. difficile shuttle vectorMutationcodon optimised for C. difficilePromoterPtetAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMA2775
Plasmid#46884PurposeLentiviral vector encoding Tet-inducible mitochondrially targeted myc-tagged E.coli exonuclease IIIDepositorInsertexonucleaseIII E. coli
UseLentiviralTagsMycExpressionMammalianPromoterTRE-TightAvailable SinceAug. 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-EGFP:Ajuba
Plasmid#108229PurposeLentiviral vector for Tet-inducible Ajuba expressionDepositorInsertAJUBA (AJUBA Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterTet/ON Minimal CMV promoterAvailable SinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJFA344C7
Plasmid#49236PurposeTET1-catalytic domain (CD) expression vector for TALE-TET1 fusion protein to induce targeted demethylation in mammalian cellsDepositorInsertTALE-TET1CD Backbone (TET1 Human, Synthetic)
UseTALEN; Tale-tet1 expression vectorPromoterEF1aAvailable SinceDec. 20, 2013AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-NGN2
Plasmid#197090PurposePiggyBac plasmid with tet-inducible expression of transcription factors for cortical neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-tetO-Esrrb
Plasmid#71152PurposeLentiviral plasmid for tetracycline/doxycycline dependent expression of murine EsrrbDepositorInsertEstrogen related receptor, beta (Esrrb Mouse)
UseLentiviralExpressionMammalianPromotertetOAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKC092_pLenti_TetON_QtEnc_IRES_RRM34_QtTP
Plasmid#242120PurposeTet- or Dox-inducible expression of QtEnc and RRM34 fused to QtTPDepositorInsertQtEnc and PABPC1 RRM34_QtTP (PABPC1 Human)
UseLentiviralMutationPABPC1 aa 191-470PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
-
pRXTN
Plasmid#47916PurposepRXTN is a modified version of pRX-tight Puro (part of the two plasmid Tet-ON system from Clontech) encoding NAT instead of PAC.DepositorTypeEmpty backboneUseRetroviralExpressionMammalianPromoterTetAvailable SinceAug. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT12nGFP
Plasmid#80420Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 12 CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 12 CTG repeats (DMPK Human)
ExpressionMammalianAvailable SinceSept. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Tet-on Advanced -BGH-PA
Plasmid#114379PurposeExpress reverse tetracycline inducible rtTA transcriptional activatorDepositorInsertrtTA and BGH-pA
ExpressionMammalianPromoterCAGAvailable SinceDec. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTet-O-APOE-E4-T2A-Puro
Plasmid#190813PurposeExpress APOE E4 allele from tet-inducible promoter, co-expressing Puro resistance geneDepositorAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-tetO-hNIL
Plasmid#197089PurposePiggyBac plasmid with tet-inducible expression of transcription factors for motor neuron differentiationDepositorAvailable SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHoss1
Plasmid#63158PurposeSuicide plasmid for efficient gene mutation in Gram-positive bacteriaDepositorInsertanti-secY-Pxyl/tetO-tetR
UseSuicide plasmid for gram-positive bacteriaAvailable SinceSept. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTRE-Tight-BI-Gl NORM-LacZA-TER-LacZB
Plasmid#86194Purposebeta Globin NMD construct with and without PTC under Bi-directional TET on promoterDepositorUseTet onExpressionMammalianMutation39TER in beta Globin in MCS IIPromoterTet onAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLBH546_Tet-Cas14b1Locus
Plasmid#112503PurposeExpresses Cas14b1 locus (including crRNA and tracrRNA) under control of a tetracycline inducible promoterDepositorInsertCas14b1
UseCRISPRExpressionBacterialPromoterTetAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLBH547_Tet-Cas14b2Locus
Plasmid#112504PurposeExpresses Cas14b2 locus (including crRNA and tracrRNA) under control of a tetracycline inducible promoterDepositorInsertCas14b2
UseCRISPRExpressionBacterialPromoterTetAvailable SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hARAF-shRNA-1
Plasmid#185370PurposeFor tetracycline-inducible mammalian expression of shRNA: GCCGTGACCAGATTATCTTTA that targets human ARAFDepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT480GFP
Plasmid#96905Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 480 interrupted CTG repeats in exon 15DepositorInsertEGFP and human DMPK exons 11-15 with 480 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBItetDT240GFP
Plasmid#96904Purposetet inducible bidirectional plasmid expressing GFP in one direction and in the other a human DMPK genomic segment containing exons 11-15 with 240 interrupted CTG repeats in exon 15 locatedDepositorInsertEGFP and human DMPK exons 11-15 with 240 interrupted CTG repeats (DMPK Human)
UseTetracycline responsive and bidirectionalExpressionMammalianPromotertetracycline responsive and bidirectionalAvailable SinceNov. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX Tight Puro Snail
Plasmid#101117PurposeTet-On SnailDepositorInsertSnail cDNA
UseLentiviralExpressionMammalianAvailable SinceOct. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
QUAS-0-T7-TetO-GFP_T7-LacO-TetR_ColE1
Plasmid#171663PurposeQUAS directly upstream of a T7 promoter with a TetO operator. Expression of TetR in BL21(DE3) E. coli. GFP is expressed according to presence of aTc. Contains the ColE1 origin of replication.DepositorInsertQUAS-T7-TetO-GFP ssrA-T7 Stop- T7-LacO-TetR-T7 Stop
TagsssrA degradation tag (DAS+4)ExpressionBacterialPromoterT7Available SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only