169,392 results
-
Plasmid#244895PurposeMinicircle producer plasmidDepositorInsertmNeonGreen
UseUnspecifiedAvailable SinceNov. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL257
Plasmid#243696PurposeA piggyBac vector containing the NDUFB9 coding sequences, modified with silent mutations to allow for PCR-based analysis, along with endogenous promoter and UTRs.DepositorAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL357
Plasmid#243711PurposeA piggyBac vector containing the COX7A2 coding sequences, modified with silent mutations to allow for PCR-based analysis, along with endogenous promoter and UTRs.DepositorAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL361
Plasmid#243714PurposeA piggyBac vector containing a synthetic reporter containing the 5' and 3' UTRs of COX7A2 flanking a partial mCherry sequence with an intronDepositorInsert5' and 3' UTRs of COX7A2 flanking a partial mCherry sequence with an intron
ExpressionMammalianAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL358
Plasmid#243712PurposeA piggyBac vector containing the COX7A2 coding sequence (CDS) flanked by the 5' UTR of the COX7A2 gene and 3' UTR of the ACTB geneDepositorInsert5' UTR and CDS of COX7A2, followed by the 3' UTR of the ACTB gene (COX7A2 Human)
ExpressionMammalianPromoterendogenous promoterAvailable SinceNov. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJL179
Plasmid#243688PurposeStably expresses SUPV3L1 CDS, flanked with endogenous 5' and 3'UTRs of ALDH18A1DepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.SynFLEX.(cyto).cpSFGFP.mRuby3
Plasmid#244914PurposecpSFGFP control with non-responsive mRuby3DepositorInsertcpSFGFP.mRuby3
UseAAVAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iATPSnFR2.A95K.mCherry
Plasmid#244919PurposeiATPSnFR2.A95K variant with non-responsive mCherryDepositorInsertiATPSnFR2.A95K.mCherry
UseAAVMutationA95KAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNoRBP.iGlucoSnFR2.mRuby3
Plasmid#244106PurposeBacterial expression of green glucose sensor with inert mRuby3DepositorInsertiGlucoSnFR2.mRuby3
TagsmRuby3ExpressionBacterialAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKG1313_pPV3-WPRE
Plasmid#239703PurposeBsaI Golden Gate assembly plasmid encoding the WPRE 3' UTR sequenceDepositorInsertWPRE 3' UTR
UseSynthetic BiologyAvailable SinceJuly 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET23a-His-TEV-SpyCatcher3
Plasmid#235149PurposeBacterial expression of His-tagged SpyCatcher3 separated by a TEV protease recognition site.DepositorInsertSpyCatcher3
TagsHisExpressionBacterialPromoterT7Available SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSrRGECO1
Plasmid#222940PurposeExpresses RGECO1 (fluorescent calcium indicator) and pac (puromycin resistance) in the Choanoflagellate, Salpingoeca rosettaDepositorInsertRGECO1
UseSalpingoeca rosetta expressionAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTYMS
Plasmid#217430PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TYMSDepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
DVA_pBR322_AG
Plasmid#217607PurposeDestination vector with ampicillin resistance and pBR322 origin of replication. Carries A-G CIDAR MoClo overhangs for level 0 or 2 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
DVC_pBR322_FG
Plasmid#217600PurposeDestination vector with chloramphenicol resistance and pBR322 origin of replication. Carries F-G CIDAR MoClo overhangs for level 1 construct cloning.DepositorTypeEmpty backboneUseSynthetic BiologyMutationNoneAvailable SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-NMD3
Plasmid#221296PurposeExpression of NMD3 (pLxIS) in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-iGABASnFR2(no bind)-WPRE
Plasmid#218876PurposeAAV-mediated expression of improved GABA sensor control (no change in fluorescence)DepositorHas ServiceAAV1 and AAV5InsertiGABASnFR2(no bind)
UseAAVExpressionMammalianMutationS99A F102G R168PPromoterSynapsinAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-ODN2
Plasmid#208643PurposeEmpty vector for long single strand DNA (up to 1.5k) preparation. Further remove BsaI and BsmBI site in pUC-ODN (Addgene #208642).DepositorTypeEmpty backboneUseLong single strand dna productionAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF3396
Plasmid#144872PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TYMS_sgRNA1
Plasmid#201628PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTYMS (TYMS Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pD649-HAsp-LBP-Fc(DAPA)-AviTag-6xHis
Plasmid#156870PurposeMammalian expression of secreted protein fused to Fc(DAPA)-Avi-6xHis.DepositorInsertLBP (LBP Human)
TagsFc(DAPA)-AviTag-6xHisExpressionMammalianMutationFc region of human IgG contains D265A and P329A m…PromoterCMV/SP6Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TYMS
Plasmid#183326PurposeAll-in-One CRISPRko system with a guide RNA that targets TYMS geneDepositorInsertTYMS
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
U24m
Plasmid#121026PurposeMoClo golden gate assembly BC part for RiboJ-BCD2 (low expression bi-cistronic RBS, engineered for context-independence, prefixed by self-cleaving RiboJ; see https://doi.org/10.1038/nmeth.2404).DepositorInsertRiboJ + BCD2
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-OTUB1 WT-pcDNA3.1
Plasmid#118209PurposeExpresses FLAG-OTUB1 WT in mammalian cellsDepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
Halo-p58
Plasmid#166896Purposemammalian expression of p58 (ie ERGIC-53; LMAN1) tagged with HaloTagDepositorInsertp58 (Lman1 Rat)
TagsHaloTagExpressionMammalianMutationL405Q, R419S- please see depositor commentsPromoterCMVAvailable SinceMay 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-FLAG-mCherry-C1-centrin-1
Plasmid#73333PurposeLentiviral vector encoding centrin-1 with N-terminal FLAG and mCherry tagsDepositorInsertcentrin-1 (CETN1 Human)
UseLentiviralTagsFLAG and mCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
SIV_Rev
Plasmid#236244Purpose3rd generation SIV-based lentiviral packaging plasmid; Contains SIV RevDepositorInsertSIV Rev
UseLentiviralAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-flpE-puro
Plasmid#20733PurposeMammalian expression of FLPe recombinase from the highly-expressed CAGGS promoter; puro selectable markerDepositorInsertFLPe recombinase
UseFlp/frtExpressionMammalianPromoterCAGGSAvailable SinceMarch 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
m6A-Tracer-NES
Plasmid#159607PurposeConstitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.DepositorInsertm6A-Tracer-NES
ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAF259
Plasmid#105494PurposepRPF185 derived plasmid encoding an anhydrotetracyclin inducible BitlucOptDepositorInsertBitlucopt
UseAtc-dependent expression in c. difficilePromoterPtetAvailable SinceSept. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSL103-SpCas9-FLAG-3XNLS
Plasmid#182032PurposeExpression of recombinant Streptococcus pyogenes Cas9 protein carrying C-terminal FLAG and 3XNLS for genome editing as Cas9 RNPDepositorInsertStreptococcus pyogenes cas9 (cas9 Synthetic)
UseCRISPRTags12X His tag, 3XNLS, FLAG, and MBPExpressionBacterialPromoterT7Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Neo-Bam p53 R248W
Plasmid#16437DepositorAvailable SinceAug. 4, 2008AvailabilityAcademic Institutions and Nonprofits only -
Sar1b-H79G-mOrange2
Plasmid#166900Purposemammalian expression of Sar1b-H79G tagged with mOrange2DepositorInsertSar1b
TagsmOrange2ExpressionMammalianMutationH79GPromoterCMVAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-EZH2
Plasmid#28060DepositorAvailable SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
C1QBP-bio-His
Plasmid#53330PurposeExpresses full-length Complement component 1 Q subcomponent-binding protein ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertC1QBP (C1QBP Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
XRE-H2B-mScarlet-I
Plasmid#182296PurposeFluorescent reporter for AhR activityDepositorInsertmScarlet-I
Tagsm-Scarlet-IExpressionMammalianAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
MMTV-cFOS-SV40
Plasmid#19259DepositorInsertcFOS
ExpressionMammalianAvailable SinceSept. 15, 2008AvailabilityAcademic Institutions and Nonprofits only -
pDEST-HisMBP
Plasmid#11085DepositorHas ServiceCloning Grade DNATypeEmpty backboneTags6xHis and MBPExpressionBacterialPromoterTac (lactose/IPTG inducible)Available SinceFeb. 14, 2006AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs N-terminal sgRNA
Plasmid#207093PurposepX330 based plasmid for expression of Cas9 and the AGCGGGACTCGGCGGCATGG sgRNA to target the DNA-PKcs locus.DepositorInsertAGCGGGACTCGGCGGCATGG
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
FFA1-Tango
Plasmid#66280PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV-CaMKIIa-GCaMP6s-P2A-nls-dTomato
Plasmid#51086PurposeForebrain principle neuron specific expression of GCaMP6s Ca sensor and physically separate nuclear localized dTomato fluorophoreDepositorInsertGCaMP6s
UseAAVTagsP2A-nls-dTomatoExpressionMammalianPromoterCaMKIIa 1.3 kbAvailable SinceMarch 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
RAD21-HaloTag Vector
Plasmid#238694PurposeExpress RAD21-HaloTag Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertRAD21 (RAD21 Human)
TagsHaloTag (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRFHUE-eGFP
Plasmid#89469PurposeGFP labelling of filamentous fungi by Agrobacterium tumefaciens mediated transformationDepositorInserteGFP
UseBinary plasmid for atmt of filamentous fungiPromoterA. nidulans gpdAAvailable SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEGFP_TOMM20_sfCherry2(11)
Plasmid#83033PurposeExpresses sfCherry2(11) tagged TOMM20 (human) in mammalian cells cellsDepositorInsertTOMM20_sfCherry+11
ExpressionMammalianAvailable SinceJan. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCI-SEP-NRI
Plasmid#23999DepositorInsertNR1 (Grin1 Rat)
TagsNR1 signal sequence (aa1-20) and SEP (supereclipt…ExpressionMammalianPromoterCMVAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
TFORF1125
Plasmid#143093PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAraH6HATT
Plasmid#63901PurposeFor expression of soluble scFv/Fab fragments in bacteria from genes selected using the pComb3H system, contains TT Fab (light and heavy chains) against tetanus toxin, used as expression control.DepositorInsertTT Fab
Tags6xHis and HA tagExpressionBacterialPromoteraraBADAvailable SinceFeb. 2, 2016AvailabilityAcademic Institutions and Nonprofits only -
pfMDH_WT
Plasmid#67721PurposeExpresses WT mannitol 2-dehydrogenase from Pseudomonas fluorescens, codon optimized for expression in E. coliDepositorInsertMannitol 2-Dehydrogenase from Pseudomonas fluorescens
Tags6x-His tagExpressionBacterialPromoterT7Available SinceSept. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJL1-dTomato
Plasmid#102631PurposeIn vitro expression of tdTomato from the T7 promoterDepositorInserttdTomato
ExpressionBacterialPromoterT7Available SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only