-
Plasmid#225948PurposeLentiviral vector plasmid expressing human CKAP4 mutations S3A S17A S19A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationS3A S17A S19APromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pCRI003-pGEM-LS-Bar-PgpdA-dSpCas9-VPR-TtrpC-LS
Plasmid#140196PurposeChromosomal integration of PgpdA-dSpCas9-VPR-TtrpC. Contains 1kb homology arms for Aspergillus nidulans and the bar gene for glufosinate selection. Filamentous fungi vector.DepositorInsertsdSpCas9-VPR
Bar
Homology arm (ChrIV_A_nidulans_FGSC_A4:2736011,2737053)
Homology arm (ChrIV_A_nidulans_FGSC_A4:2790295,2791327)
UseCRISPR and Synthetic Biology; Fungal genome integ…TagsVPR (VP64-p65-Rta) , NLSExpressionMutationPromoterPgpdA and PtrpCAvailable sinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
GABA(A) receptor subunit a2SE
Plasmid#49169PurposepHluorin-tagged GABA A receptor subunit (alpha 2) produces minimal fluorescence during trafficking and a robust fluorescent signal at the cell surfaceDepositorInsertGABA(A) receptor subunit alpha-2 (GABRA2 Human)
UseTagsHA, bovine alpha 1 signal sequence, and pHGFP (pH…ExpressionMammalianMutationT343APromoterCMVAvailable sinceDec. 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCW57.1 blast OFF 3xflag IREB2
Plasmid#169889PurposeExpress 3x flag IREB2, suppressible by doxycycline additionDepositorInsertIREB2 (IREB2 Human)
UseLentiviral; Doxycycline mediated suppressionTags3x FlagExpressionMammalianMutationSilent mutations in sgIREB2_1 and sgIREB2_2 targe…PromoterTREAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3 1-90
Plasmid#75137PurposeExpresses N-terminal Flag-tagged amino acids 1-90 of NLRP3 (the pyrin domain) in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
UseTagsFlagExpressionMammalianMutationfragment encoding amino acids 1-90PromoterCMVAvailable sinceMay 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-HA-NEK7 K64M
Plasmid#75143PurposeExpresses N-terminal HA-tagged NEK7 (with a K64M substitution; kinase dead) in mammalian cellsDepositorInsertNIMA (never in mitosis gene a)-related expressed kinase 7 (Nek7 Mouse)
UseTagsHAExpressionMammalianMutationLys 64 mutated to Met; kinase inactive and F236L …PromoterCMVAvailable sinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
KIF5A-GFP-SspB
Plasmid#214401PurposeExpresses fusion of Kinesin heavy chain 5A (1-572) with GFP and SspB (micro)DepositorInsertKIF5A-GFP-SspB (Kif5a Rat, Synthetic)
UseTagsKIF5A-GFP-SspBExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hATG7CS
Plasmid#87868PurposeExpress a active-site mutant human Atg7/Apg7 C572S in mammalian cellsDepositorInsertATG7 C572S mutant (ATG7 Human)
UseTagsExpressionMammalianMutationC572S mutantPromoterCMVAvailable sinceAug. 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Flag-FBW7K404R
Plasmid#200717PurposeThe plasmid expresses Flag-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
UseTagsFlagExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn T21R-F8.2 (S54L+T127A)-T2A-mCherry
Plasmid#225590PurposeAAV transgene plasmid with hSyn promoter for expression of TRIM21 RING-F8.2(S54L+T127A) anti-tau degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-F8.2 (S54L+T127A)-T2A-mCherry
UseAAVTagsmCherryExpressionMammalianMutationPromoterhSynAvailable sinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pDEST-GST-FBW7 alpha
Plasmid#197456PurposeThe plasmid expresses GST-tagged FBW7 human isoform 1. Used for in vitro translation of FBW7alpha.DepositorInsertFBW7 (FBXW7 Human)
UseIn vitro translationTagsGSTExpressionBacterialMutationSee depositor comments belowPromoterT7Available sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SynI-CreOn-FlpOff-Kir2.1-P2A-EGFP
Plasmid#176278PurposeViral vector for co-expression of Kir2.1 and EGFP in cells expressing Cre AND NOT Flp driven by the human Synapsin promoter.DepositorInsertKir2.1-P2A-EGFP (Kcnj2 Mouse, Synthetic)
UseAAV and Cre/LoxTagsMycExpressionMammalianMutationPromoterhuman Synapsin IAvailable sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
SOX2-P2A-tagBFP-HDR
Plasmid#163751PurposeHDR knock-in template for tagging the human endogenous SOX2 gene with a tagBFP fluorescent marker linked by a self-cleaving P2A peptide.DepositorInsertSOX2 (SOX2 Human)
UseCRISPR and Synthetic BiologyTagsP2A-tagBFPExpressionMutationDoes not contain start codon to avoid random inte…PromoterAvailable sinceOct. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRI005-pYFAC-riboB-PgpdA-dLbCpf1(D156R)-VPR-TtrpC
Plasmid#140198PurposeEpisomal expression of dLbCpf1(D156R)-VPR, variant for culture at room temperature. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a(D156R)-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSExpressionMutationD832A DNase deactivated, D156R for improved activ…PromoterPgpdAAvailable sinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
t1-405
Plasmid#166127PurposeFor expression of human talin-1 head (residues 1-405) in E. coli. N-terminal His6-tag, Xpress-epitope (DLYDDDDK) and enterokinase cleavage site for tag removal.DepositorInsertTln1Head (1-405) (TLN1 Human)
UseTagsHis6-tag, Xpress-epitope (DLYDDDDK) and enterokin…ExpressionBacterialMutationresidues 1-405 onlyPromoterAvailable sinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EFS-SaKKH-spA-miniU6-miniSdd6-MmHPD-T2
Plasmid#204852PurposeAAV vector for cytosine base editing using miniSdd6 at HPD-T2 target site in mouseDepositorInsertminiSdd6-nSaCas9KKH(D10A)-UGI
UseAAV and CRISPRTagsExpressionMutationD10A, E782K, N968K, R1015H in SaCas9PromoterEFS, miniU6Available sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
dCas9-GCN5 FL
Plasmid#179552Purposeencodes S. pyogenes dCas9 with c-terminal fusion of full length human GCN5 driven by EF-1alpha promoterDepositorInsertS. pyogenes dCas9 with c-terminal fusion of full length human GCN5 (KAT2A Human)
UseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
iLID-tdTomato-Omp25
Plasmid#214400PurposeExpresses fusion of iLID with tdTomato and transmembrane domain of Omp25DepositorInsertiLID-tdTomato-Omp25 (Synj2bp Rat, Synthetic)
UseTagsiLID-TdTomato-Omp25ExpressionMammalianMutationPromoterCMVAvailable sinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FKBP-Kras-Blasticidin
Plasmid#120714PurposeExpresses membrane-targeted recruiter protein in mammalian cells & for virus productionDepositorInsertKRAS4B (KRAS Human)
UseLentiviralTagsFKBP and mCherryExpressionMammalianMutationamino acids 158-188PromoterCMVAvailable sinceJan. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4(2xlumen)-WPRE-UbC-Emerald
Plasmid#225956PurposeLentiviral vector plasmid expressing human CKAP4 mutant with an additional luminal domain under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsExpressionMammalianMutationFull-length CKAP4 with additional luminal domain …PromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-STIM1-WPRE-UbC-Emerald
Plasmid#225939PurposeLentiviral vector plasmid expressing human stromal interaction molecule 1 (STIM1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-myc-ATL1-WPRE-UbC-Emerald
Plasmid#225944PurposeLentiviral vector plasmid expressing human atlastin GTPase 1 (ATL1) fused to myc-tag under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralTagsmyc-tagExpressionMammalianMutationPromoterSFFV and UbCAvailable sinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-hMICU1EF
Plasmid#199180PurposeThis plasmid is used to express a EF-hand disabled human MICU1 protein in E. coli. The protein is fused with a maltose binding protein in the N-terminus, and also contains a C-terminal His6 tag.DepositorInsertMICU1 (MICU1 Human)
UseTagsHis6 and MBP, Thrombin site, TEV siteExpressionMutationD421A, E432K, F433W, F453WPromoterAvailable sinceAug. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7]K404R
Plasmid#200715PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 to Arg mutation. Used for overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
UseTagsMycExpressionMammalianMutationFBW7 K404 is mutated to Alanine.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7 Delta D-Domain
Plasmid#197453PurposeThe plasmid expresses D-domain deleted version of Myc-tagged FBW7 human isoform 1. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
UseTagsMycExpressionMammalianMutationFBW& dimerization domain deleted.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Myc-FBW7K404/412/R
Plasmid#200716PurposeThe plasmid expresses Myc-tagged FBW7 human isoform 1 with Lys404 & 412 to Arg mutation. Used for mammalian overexpression and detection by western blotting.DepositorInsertFBW7 (FBXW7 Human)
UseTagsMycExpressionMammalianMutationFBW7 K404 and K412 mutated to Alanines.PromoterCMVAvailable sinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO CLDN1 2xgRNA - spCas9 iRFP670 puro
Plasmid#166133PurposeThis plasmid allows efficient KO of the cldn1 gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting cldn1 gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti KO Luc Firefly 2xgRNA - spCas9 iRFP670 puro
Plasmid#166134PurposeThis plasmid allows efficient KO of the firefly luciferase gene, while expressing the far red fluorescent protein iRFP670 and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting firefly luciferase gene
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianMutationPromoterAvailable sinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-FUS/TLS-FLAGC
Plasmid#60362PurposePlasmid for expression of FLAG-GFP tagged human FUS/TLS (C-terminal tag). Confers resistance to G418.DepositorInsertFUS (FUS Human)
UseTagsFLAG and GFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-GW
Plasmid#60323PurposeThis is a modified version of the pGL4.23 vector from Promega, containing a Gateway cassette upstream of the minimal promoter. This vector can be used for for Gateway cloning of candidate enhancer elements. As negative control, use pGL4.23 without the gateway cassette (available from Promega).DepositorTypeEmpty backboneUseLuciferaseTagsLuciferaseExpressionMammalianMutationPromoterAvailable sinceDec. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-pro-Il1b-C-Flag
Plasmid#75131PurposeExpresses C-terminal flag-tagged pro-IL-1β in mammalian cellsDepositorInsertinterleukin 1 beta (Il1b Mouse)
UseTags3XFLAGExpressionMammalianMutation(please see depositor comments below)PromoterCMVAvailable sinceSept. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAD-bARGSer-AxeTxe
Plasmid#192473PurposeSecond-generation bacterial acoustic reporter gene derived from SerratiaDepositorInsertsbARGSer
AxeTxe
UseTagsExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterNative promoter from Enterococcus faecium and pBADAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetOminiCMV-OSK
Plasmid#136552PurposeDox-inducible polycistronic reprogramming lentiviral vector expressing mouse Oct4, Sox2, Klf4DepositorUseLentiviralTagsExpressionBacterialMutationPromotertetO-miniCMV (dox-inducible)Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
TRE-mClover3-TDP-43ΔNLS
Plasmid#214917Purposeinducible expression of TDP-43 harboring mutant NLS and N-terminal mClover3. Expression yields cytosolic TDP-43 that forms peinuclear punctaDepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMarch 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pcDNA3.2 TDP-43 NLS1 YFP
Plasmid#84912PurposeMammalian expresion of TDP-43 NLS1 YFPDepositorInsertTDP-43 (TARDBP Human)
UseTagsYFPExpressionMammalianMutationK82A, R83A, K84APromoterCMVAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA-
Plasmid#229698PurposeTransient expression of GFP-alpha-cateninA- in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationL785A, I792A, V796APromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3ExpressionMutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…PromoterAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1 PA-PLA1 (EGFP-PA-PLA1)
Plasmid#162880PurposeExpression in mammalian cells of Phosphatidic Acid preferring Phospholipase A1 tagged with EGFPDepositorInsertPhosphatidic acid-preferring phospholipase A1 (PA-PLA1) (DDHD1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterAvailable sinceJan. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninΔβH
Plasmid#229705PurposeTransient expression of GFP-alpha-catenin-delta-beta-H in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+
Plasmid#229697PurposeTransient expression of GFP-alpha-cateninA+ in mammalian cells; enhanced actin bindingDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninA+ΔβH
Plasmid#229704PurposeTransient expression of GFP-alpha-cateninA+deltabetaH in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationamino acids 670-673, RAIM--> GSGSPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-α-cateninWT
Plasmid#229709PurposeTransient expression of GFP-alpha-cateninWT in mammalian cellsDepositorInsertCTNNA1 (alpha-catenin) Human (CTNNA1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMV promoterAvailable sinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.2 TDP-43 NLS1, 5F-L YFP
Plasmid#84913PurposeMammalian expresion of TDP-43 NLS1, 5F-L YFPDepositorInsertTDP-43 (TARDBP Human)
UseTagsYFPExpressionMammalianMutationK82A, R83A, K84A, F147L, F149L, F194L, F229L, F23…PromoterCMVAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30D
Plasmid#214672PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs downstream of the 5′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
lucMAPT-30U
Plasmid#214673PurposeMAPT Exon 10 reporter containing the MS2 hairpin 30 base pairs upstream of the 3′ splice siteDepositorInsertMAPT (MAPT Human)
UseTagsFirefly Luciferase, Renilla Luciferase, and V5ExpressionMammalianMutationContains Exon 9, Exon 10 with a mutation to intro…PromoterCMVAvailable sinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-N-Flag-NLRP3 711-1034
Plasmid#75141PurposeExpresses N-terminal Flag-tagged amino acids 711-1034 of NLRP3 (the LRR domain) in mammalian cellsDepositorInsertNLR family, pyrin domain containing 3 (Nlrp3 Mouse)
UseTagsFlagExpressionMammalianMutationfragment encoding amino acids 711-1034PromoterCMVAvailable sinceMay 26, 2016AvailabilityAcademic Institutions and Nonprofits only