We narrowed to 1,564 results for: CAG promoter
-
Plasmid#91666PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only
-
LentiU6-hASCL1 gRNA_1-MS2-Puro
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA-d5-HT1AR
Plasmid#221820PurposePlasmid to express gRNA (gaccagtccactaccgcagc) for editing at the end of Drosophila 5-HT1AR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shYAP1-1
Plasmid#193692PurposeConstitutive lentiviral expression of YAP1 shRNADepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHes1-DsRed
Plasmid#13767DepositorInsertHes1 promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pNrl-DsRed
Plasmid#13764DepositorInsertNrl promoter
TagsDsRed2ExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shCELF4-4404
Plasmid#115465PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shMBNL1-3964
Plasmid#115459PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shCALM2-1
Plasmid#193699PurposeConstitutive lentiviral expression of CALM2 shRNADepositorInsertCALM2 (CALM2 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
lentiCRISPR v2-Nr4a1 double gRNAs
Plasmid#162791PurposeMultiplex Guide RNAs to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro-Nono-sh5
Plasmid#127651PurposeKnock-down of human NONODepositorInsertNONO shRNA (NONO Human)
UseLentiviralAvailable SinceJuly 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2911
Plasmid#161764PurposeMODULE C plasmid compatible with the Voytas Plant Genome Engineering Tool kit with an Agrobacterium promoter rolD expressing the TREX2 exonuclease.DepositorInsertrolD:TREX2
ExpressionBacterialPromoterrolDAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-puro
Plasmid#65230Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
shERK2b-mlpx-neo
Plasmid#65231Purposeencodes a shRNA against ERK2DepositorAvailable SinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-Fgf5Pro
Plasmid#227479Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Fgf5 promoter
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-tdTomato
Plasmid#159275PurposeHuman AAVS1 targeting vector for knockin of a CAGGS promoter-driven tdTomato cassette (cloned between AgeI and PacI). Targeted cells will be puromycin resistant.DepositorInserttdTomato
UseAAV; S1 knockin donor vectorExpressionMammalianPromoterCAGGSAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEMS1988
Plasmid#49119PurposeAAV plasmid with CAGGS promoter driving expression of iCre.DepositorInsertssAAV-CAGGS-iCre
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1989
Plasmid#49120PurposeAAV plasmid with CAGGS promoter driving expression of iCre. Contains WPRE.DepositorInsertssAAV-CAGGS-iCre-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2058
Plasmid#49136PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP. Contains WPRE.DepositorInsertssAAV-CAGGS-emGFP-WPRE
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS2050
Plasmid#49135PurposeAAV plasmid with CAGGS promoter driving expression of EmGFP.DepositorInsertssAAV-CAGGS-emGFP
UseAAVExpressionMammalianPromoterCAGGSAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pRho-Cre
Plasmid#13779DepositorInsertRhodopsin promoter-Cre
UseCre/LoxTagsMycExpressionMammalianAvailable SinceApril 20, 2007AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
G10 Cas9 MDC123
Plasmid#59187PurposeG10 promoting Glycing Max codon optimized Cas9 (N and C terminus NLS) with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoterG10Available SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
Cas9 MDC123
Plasmid#59184Purpose2x35S promoting Glycing Max codon optimized Cas9 with bar plant selectionDepositorInsertGlycine Max codon optimized Cas9
UseCRISPRExpressionPlantPromoter2X35SAvailable SinceNov. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_A
Plasmid#72620PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_TFRC_B
Plasmid#72626PurposeExpresses two gRNAs targeting the TFRC promoterDepositorInsertgRNAs toward TFRC
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_B
Plasmid#72621PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available SinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-d5-HT2BR
Plasmid#221827PurposePlasmid to express gRNA1 (ttcagtttgcccggtttaac) for editing at the end of Drosophila 5-HT2BR coding frameDepositorAvailable SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
AAVS1-Blasticidin XLone-eGFP
Plasmid#159754PurposeAAVS1 donor plasmid for targeted inducible eGFP expression in human cellsDepositorInsertall-in-one tet-on system
UseCRISPR and TALEN; Donor plasmid for targeted knoc…ExpressionMammalianPromoterTRE3GS inducible promoterAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-HA-AT1R-YFP
Plasmid#101659PurposeExpresses AT1R with HA tag and YFP in mammalian cells.DepositorInsertAngiotensin II type 1 receptor (AGTR1 Human)
TagsHA and YFP (Venus)ExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCXN2-FLAG-AT2R-CFP
Plasmid#101660PurposeExpresses AT2R with FLAG tag and CFP in mammalian cells.DepositorInsertAngiotensin II type 2 receptor (AGTR2 Human)
TagsECFP and FLAGExpressionMammalianPromoterCAG promoterAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBT270_(pCA-G-intron(Neo)-tTA2-iiTRE-tdT3Mycii)
Plasmid#36881DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Hb9-CD14
Plasmid#204344PurposeKnock-in vector to insert a motor neuron-specific MACS-sortable genetic reporter into the AAVS1 locus in human pluripotent stem cells. Allows isolation of human iPSC-derived motor neurons.DepositorAvailable SinceSept. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PBGFAP-eGFP
Plasmid#40975DepositorInsertMouse GFAP promoter fragment
ExpressionMammalianAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC44
Plasmid#104818PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from AtUBQ10 promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-tRNA
Plasmid#161761PurposeMODULE B tRNA vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2303 - #91068)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMOD_B-Pho2-1/2-2-Csy4
Plasmid#161760PurposeMODULE B Csy4 vector with 6x gRNAs targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pMOD_B2103 - #91061)DepositorInsertgRNAs
ExpressionBacterialPromoterCmYLCV PromoterAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC45
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TDP-43 mRuby K84ONBK
Plasmid#216226PurposeTDP-43 with a C-terminal mRuby tag and Lysine 84 in the NLS mutated to a TAG stop codon for amber codon suppression.DepositorInsertTransactive response DNA binding protein of 43 kDa (TARDBP Human)
ExpressionMammalianMutationLysine 84 mutated to a TAG stop codonPromoterCMV PromoterAvailable SinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPN273
Plasmid#91644PurposeExpress sgRNA targeting human MMP16DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SBC015866
Plasmid#226280PurposeExpresses BsSfp, MsCAD, and SrCAR from trc promoter. Biosynthesis of (hydroxy)cinnamyl alcohols from (hydroxy)cinnamic acids.DepositorInserts4'-phosphopantetheinyl transferase Sfp
Cinnamyl alcohol dehydrogenase
Carboxylic acid reductase
ExpressionBacterialAvailable SinceNov. 25, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLG1-puro-sgATL2-1
Plasmid#109008PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only