We narrowed to 1,634 results for: CAG promoter
-
Plasmid#118640PurposeTransient transfection; Expresses dCasRx-FKBP; CAGGS promoterDepositorInsertdCasRx-FKBP
UseCRISPRExpressionMammalianPromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAC1801_pmax-dCasRx
Plasmid#118634PurposeTransient transfection; Expresses dCasRx; CAGGS promoterDepositorInsertdCasRx
ExpressionMammalianMutationR239A/H244A/R858A/H863APromoterCAGGSAvailable SinceJan. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF3-sh3
Plasmid#69044Purpose3rd generation lentiviral vector expressing IKZF3 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb2
Plasmid#162794PurposeCcnb2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBub1
Plasmid#160948PurposeBub1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX459_NRF2-exon5-1
Plasmid#177781PurposesgRNA for CRISPR/Cas9-mediated deletion of human NRF2DepositorInsertNRF2 (NFE2L2 Human)
UseCRISPRAvailable SinceAug. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shKif11
Plasmid#160962PurposeKif11 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shAspm
Plasmid#160947PurposeAspm shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdkn3
Plasmid#160955PurposeCdkn3 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pimEJ5GFP
Plasmid#44026DepositorInsertEJ5GFP egfp-based chromosomal break reporter
ExpressionMammalianMutationpCAGGS promoter and eGFP separated by pgkPURO cas…PromoterpCAGGSAvailable SinceMay 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
BLBP-GFP
Plasmid#63174PurposeExpressing GFP from BLBP promoter which is a neural stem cell (radial glial cells) specific promoterDepositorAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1-1609-del1384-1524-siRNAres_N
Plasmid#147024PurposeMammalian Expression of HsTNRC6A_1-1609-del1384-1542-siRNAresDepositorInsertHsTNRC6A_1-1609-del1384-1542-siRNAres (TNRC6A Human)
ExpressionMammalianMutationone non silent mutation K1578E compared to the se…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Neo-GFP/V5-Foxa1-(P2A)-Flag-Gata5
Plasmid#105509PurposeMSCV-driven retroviral Foxa1 and Gata5 expression (P2A-linked, V5 and Flag-tagged each)DepositorAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAS-mak10 gRNA
Plasmid#160385PurposeExpresses guide RNA for targeting MAK10 in yeastDepositorInsertmak10 gRNA
ExpressionYeastPromoterRNA pol III promoter (tRNA-Tyr)Available SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
TLCV2-RB1
Plasmid#87836PurposeLentiCRISPR v2 was modified into an all-in-one dox inducible system. The addition of doxycycline induces Cas9-2A-eGFP. The U6 promoter drives constitutive expression of an sgRNA targeting human RB1.DepositorInsertsgRB1 (RB1 Human)
UseCRISPR and Lentiviral; Doxycycline inducible; egf…ExpressionMammalianPromoterTight TRE promoter and U6Available SinceApril 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pSuper Retro GFP DGK alfa human
Plasmid#224578PurposeTo stably downregulate the expression of human DGK alfa in human cellsDepositorAvailable SinceSept. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSico_U6-PLOD2 sgRNA3
Plasmid#136458PurposeExpression of gRNA against human PLOD2DepositorInsertgRNA against human PLOD2 (PLOD2 Synthetic, Human)
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Empty Bridge Control Zfp462-Klf4SE
Plasmid#127666PurposeEncodes for 4 gRNAs expressed from their individual hU6 promoters. Two gRNAs target the Zfp462 promoter while the other two target the Klf4 stretch enhancer.DepositorInsertgRNAs 129, 135, 115, 117
UseCRISPRExpressionMammalianPromoterhU6Available SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-SDHB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172670PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human SDHB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertSDHB pegRNA and SDHB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-ALDOB_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172668PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human ALDOB gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertALDOB pegRNA and ALDOB_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceNov. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMADM-alpha
Plasmid#36890DepositorInsertsGFP
tdTomato-3Myc
beta-globin intron
Neo
ATG (T)
GFP
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, deleted…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 17, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPN282
Plasmid#91665PurposeExpress sgRNA targeting human SDCCAG8DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
1197R_gZBF-ER
Plasmid#241825PurposegRNA expressing plasmid with broken SEPARATORDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_multi1-3-MS2-Puro
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ADAR2-2a-Fezf2 sesRNA-2a-tTA2-WPRE
Plasmid#239027PurposeExpression of ADAR2, sesRNA in mammalian cells with hSyn promoter, with tTA2 as efRNA and ADAR2 overexpression.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-42:AAVS1-mTagRFPT-CAAX
Plasmid#107580PurposeHomology arms, promoter and linker-mTagRFPT-CAAX sequence for internal insertion of CAGGS-driven mTagRFPT-CAAX at the AAVS1 safe harbor location in human cellsDepositorInsertAAVS1 Homology Arms with CAGGS-driven mTagRFPT-CAAX (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceMay 9, 2018AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX459-sgAAVS1
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 puro shSLC2A1-2
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCas9-sgCh2-2-Blast
Plasmid#199645PurposeExpresses Cas9 and sgRNA control guide targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shRBFOX1-3260
Plasmid#115457PurposeConstitutive lentiviral expressionDepositorAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SwitchON-sgCh2-2
Plasmid#199637PurposeTamoxifen-inducible expression of sgRNA control targeting intergenic regionDepositorInsertN/A
UseLentiviralAvailable SinceJune 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSPneogRNA241510+MT
Plasmid#84292PurposeExpress LdPBK_241510.1 and LdMT targeting gRNAs simutaneouslyDepositorInsertLdBPK_241510.1 targeting gRNA and LdMT targeting gRNA
UseCRISPR; Leishmania donovaniPromoterL. donovani ribosome RNA promoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-5
Plasmid#193671PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-eGFP-shLacZ
Plasmid#223222Purposemir30 based shRNA strategy, control shRNADepositorInsertshLacZ
UseAAVAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-6
Plasmid#193667PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G4_Q118R_Std_BFP-to-EGFP_Dual_epegRNA_tevopreQ1
Plasmid#187459PurposeControl vector for coselection for prime editing in human cells. Tandem expression of ATP1A1 Q118R-G4 pegRNA and EBFP_To_EGFP epegRNA (tevopreq1) from two independent U6 promoters.DepositorInsertATP1A1 G4 Q118R pegRNA + EBFP to EGFP epegRNA (tevopreq1) (ATP1A1 Human)
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceJuly 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti_CRISPRi_sgAR1
Plasmid#167000PurposeLentiviral expression of sgRNA targeted to the androgen receptor (AR) promoter for CRISPRi knockdownDepositorAvailable SinceApril 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA1
Plasmid#160945PurposeGuide RNA 1 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
-161+80pCalb2/dmutNRF-1(-41;-35)-like
Plasmid#66741Purposeluciferase reporter for Calb2 promoter (-161to +80, mutant)DepositorInsertCalb2 promoter (-161bp+80) (CALB2 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCGCAGGCGC (-41;-35) to ATTAGGATTPromoterCalb2Available SinceJan. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-iRFP670-P2A-puro
Plasmid#208399Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, iRFP670 fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsiRFP670ExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-Crimson-P2A-puro
Plasmid#208398Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, E2-Crimson fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsE2-CrimsonExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti gRNA KO OCLNx2 spCas9-T2A-mNeonGreen-P2A-puro
Plasmid#208400Purposecodes for 2 gRNA-TracrRNA targeting human OCLN, Cas9, mNeonGreen fluorescent protein and puromycin resistanceDepositorInserthU6-gRNA and hH1-gRNA targeting OCLN gene (OCLN Human)
UseCRISPR and LentiviralTagsmNeonGreenExpressionMammalianAvailable SinceDec. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-PrPro
Plasmid#227453Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-PrPro
Plasmid#227454Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to Prdm8 promoter Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only