We narrowed to 2,167 results for: CO
-
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only
-
MK01_HUMAN_D0
Plasmid#79713PurposeThis plasmid encodes the kinase domain of MK01. Intended for co-expression with Lambda Phosphatase that accompanies this set to enhance bacterial kinase expression.DepositorAvailable SinceNov. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_1k)-PGKpuro2ABFP-W
Plasmid#208416PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_1k)-PGKpuro2ABFP-W
Plasmid#208410PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_on-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233373PurposeEF1α driven co-expression of the consitutively active kinase activity recorder positive control Kinprola_on fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_on-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti_EF1α-NES-Kinprola_PKA_T/A-mEGFP_bGH-PA term_EF1α_FLAG-SV40NLS-Cas9-NLS-T2A-BSD-WPRE-SV40
Plasmid#233372PurposeEF1α driven co-expression of the inactive PKA activity recorder negative control with T/A mutation Kinprola_PKA_T/A fused to mEGFP and Cas9 expression through lentivirus transductionDepositorInsertsNES-Kinprola_PKA_T/A-mEGFP
FLAG-SV40NLS-Cas9-NLS-T2A-BSD
UseLentiviralTagsFLAG, NES, and mEGFPPromoterEF1αAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-FLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
Plasmid#220609PurposeNeuron-specific, Cre-dependent co-expression of FLAG-tagged inhibitory hM4D(Gi) DREADD receptor, and a single-cell discriminating version of AausFP1 as a reporter.DepositorInsertFLAG-hM4D(Gi)-P2A-ArgiNLS-AausFP1
UseAAV and Cre/LoxTagsFLAG; ArgiNLSExpressionMammalianPromoterhSynAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook3_FTS_FHIP1B
Plasmid#222299PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK3 and FHIP1B) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionBacterialAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBIG1a_StrepII-Hook2_FTS_FHIP2A
Plasmid#222302PurposeCo-expresses full-length human FHF (FTS, StrepII-HOOK2 and FHIP2A) in a pBIG1a vectorDepositorTagsStrepII-PscExpressionInsectAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pETDUET-GST-AUP1 379-410:Ube2G2
Plasmid#185335PurposeUsed for co-expression of the AUP1 G2BR with UBE2G2 for crystallographyDepositorAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hCHAT)-PGKpuro2ABFP-W
Plasmid#163147PurposeLentiviral gRNA plasmid targeting human CHAT gene, co-expression of BFP tagDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W2B)-PGKpuro2ABFP-W
Plasmid#163175PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2ABFP-W
Plasmid#163174PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of BFP tagDepositorAvailable SinceSept. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pnCS_SEPT7_SEPT9_i1-i5-TEV-Strep
Plasmid#180314Purposebacterial co-expression of human SEPT7 and of human SEPT9_i1-i5DepositorTagsTEV-StrepExpressionBacterialMutationSEPT9_i1-i5Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAB(EXPR-DS-HDAC5_HDAC3)
Plasmid#114399PurposeFor PYL-HDAC5 catalytic domain swap to HDAC3 catalytic domain expressionDepositorTags3xFlag-NLS (internal)ExpressionMammalianPromoterCMVAvailable SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2ABFP-W
Plasmid#163170PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hYAP1-Y1K)-PGKpuro2AmCherry-W
Plasmid#163172PurposeLentiviral gRNA plasmid targeting human YAP1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pABD933
Plasmid#67917PurposeEntry clone made prior to studies of protein co-localization of CTG10 via fluorescent fusion after transient expression in plantaDepositorInsertCTG10
UseGateway cloning vectorAvailable SinceDec. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based tension sensor)
Plasmid#118719PurposeThe acceptor (mCherry) only control for the F40-based human desmoplakin II tension sensor can be co-expressed with the donor (YPet(short)) only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II-[YPet(short)(Y67G)-F40-mCherry] (internal-1353) (DSP Human)
UseRetroviralTagsYPet(short)(Y67G)-F40-mCherryExpressionMammalianMutationinserted F40-based tension sensor module after aa…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Desmoplakin II acceptor only control (F40-based no force control)
Plasmid#118720PurposeThe acceptor (mCherry) only control for the no force control of the F40-based human desmoplakin II tension sensor can be co-expressed with the donor only control to determine intermolecular FRET.DepositorInserthuman Desmoplakin II (1-1353)-[YPet(short)(Y67G)-F40-mCherry] (DSP Human)
UseRetroviralTagsYPet(short)-F40-mCherry(Y72L)ExpressionMammalianMutationtruncation after aa1353; Y67G mutation in YPet(sh…PromoterCMVAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-beta-1 in pcDNAI/Amp
Plasmid#55707PurposeAn amino-terminal fragment of mCerulean was fused to Gbeta1. When co-expressed with a carboxyl terminal CFP fragment fused to a Ggamma subunit, a fluorescent signal s produced.DepositorInsertmCer(1-158)-beta 1 (GNB1 Aequorea victoria, Human)
TagsCer(1-158) was fused to the amino terminus of Gbe…ExpressionMammalianMutationGBeta-1 was amplified via PCR, which removed an i…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
Cer(159-238)-beta-5 in pcDNAI/Amp
Plasmid#55778PurposeA carboxyl-terminal mCerulean fragment was fused to Gbeta-5. When co-expressed with an amino terminal mCerulean fragment fused to a Ggamma subunit, a fluorescent signal is produced.DepositorInsertCer(159-238)-beta-5 (GNB5 Aequorea victoria, Human)
TagsmCer(159-238) was fused to the amino terminus of …ExpressionMammalianMutationGBeta-5 was amplified via PCR, which added an N-t…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual wt p110α/p85α
Plasmid#199302Purposeco-expression of His-tagged p110α wt and Avi-tagged p85α wt proteinsDepositorTagsAvi and HisExpressionInsectAvailable SinceJune 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-U6-dgRNA-CAG-MPH
Plasmid#106259PurposeExpresses MPH co-activator from the CAG promoter and one U6-driven dgRNA in AAV backboneDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 frt/to N-BioTAP-C-BRD4-NUT
Plasmid#171630PurposeExpresses BioTAP-tagged BRD4-NUT in mammalian cells. Can be inserted into a FRT site by co-transfection with a plasmid encoding Flp recombinaase.DepositorAvailable SinceAug. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
COVID-SARS2 NSP14/10
Plasmid#159613PurposeBacterial co-expression vector fo Covid-SARS2 NSP14 and NSP10DepositorInsertsTagsHis6, TEV cleavage site and noneExpressionBacterialMutationCodon-optimized for E. coli expressionPromoter(Bicistronic) and T7 - LacOAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND3-IRES-mCherry
Plasmid#172620PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D3 and mCherry in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMG051 MBP-β-catenin-His, GST-CK1α
Plasmid#154072PurposeCo-expresses MBP-β-catenin-His (human β-catenin as a fusion protein with MBP and His- tags) and GST_CK1α in E.coli to produce primed MBP-β-catenin-HisDepositorTagsGST, His6, and MBPExpressionBacterialPromoterTacAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND2-IRES-mCherry
Plasmid#172627PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D2 and mCherry in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rInsp-hIns-GLuc
Plasmid#89927PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Human, Synthetic)
UseLentiviralExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…Promoter410bp rat insulin II promoterAvailable SinceAug. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1+(rInsp)-Ins-GLuc
Plasmid#89928PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.DepositorInserthuman insulin-Gaussia-Luciferase (INS Human, Synthetic)
ExpressionMammalianMutationDNA sequence for Gaussia luciferase was humanized…Promoterrat Insulin II promoterAvailable SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1aL-Cre-IRES-NeoR-W
Plasmid#126700Purposelentiviral or plasmid based co-expression of Cre recombinase and a neomycin resistance cassetteDepositorInsertCre-IRES
UseCre/Lox and LentiviralTagsSV40 NLSPromoterEf1aAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLVX-2xFLAG-2xSTREP-CCND1-IRES-mCherry
Plasmid#172640PurposeLentiviral bicistronic vector for the constitutive co-expression of 2xFLAG-2xSTREP-tagged cyclin D1 and mCherry in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDFDuet-1 MKK4(EE)-MKK7a1(EE)
Plasmid#47580PurposeBacterial expression plasmid for co-expression of constitutively active MKK4 and MKK7a1DepositorExpressionBacterialMutationLacks the first 36 residues of the RefSeq protein…Available SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EmGFP-LATS2/1 KD
Plasmid#52085PurposeLentiviral RNAi vector for knockdown of LATS2 and LATS1. Co-expresses EmGFP as reporterDepositorAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
hU6-pegRNA-EFS-mScarlet Template
Plasmid#196037PurposeThe template UPEmS vector designed for cloning of a single pegRNA and subsequent co-expression with mScarlet.DepositorInsertmScarlet
ExpressionMammalianPromoterhU6 and EFSAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
hU6-pegRNA-EF-1α-Cre Template
Plasmid#196036PurposeThe template UPEC vector designed for cloning of a single pegRNA and subsequent co-expression with Cre.DepositorTypeEmpty backboneExpressionMammalianPromoterhU6 and EF-1-alphaAvailable SinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDmelOR-mRho.V5.mER.hOr56a
Plasmid#126479PurposeHuman codon-optimized D. melanogaster Orco (hOrco) and Or56a (hOr56a). Or56a has N-terminal tags derived from human Rhodopsin (mRho) and HCN1 (mER) for improved trafficking in mammalian cellsDepositorTagsH. sapiens HCN1 106VNKFSL111 (mER), H. sapiens Rh…ExpressionMammalianMutationcodon optimization for H. sapiens and codon optim…PromoterCMVAvailable SinceJune 13, 2019AvailabilityAcademic Institutions and Nonprofits only