-
Plasmid#185300PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC_98-130 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC_98-130
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DSUP_RAMVA_1-208_mCh-SspB (pBS1073)
Plasmid#185296PurposeFor the mammalian expression of the tardigrade protein DSUP_RAMVA_1-208 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDSUP_RAMVA_1-208
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
DHR93_Nccapped_mCh-SspB (pBS1072)
Plasmid#185295PurposeFor the mammalian expression of the synthetic protein DHR93_Nccapped attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertDHR93_Nccapped
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE3_47-300_mCh-SspB (pBS1070)
Plasmid#185293PurposeFor the mammalian expression of the human protein ApoE3_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE3_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE4_47-300_mCh-SspB (pBS1069)
Plasmid#185292PurposeFor the mammalian expression of the human protein ApoE4_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE4_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
ApoE2_47-300_mCh-SspB (pBS1068)
Plasmid#185291PurposeFor the mammalian expression of the human protein ApoE2_47-300 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertApoE2_47-300
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS2-CAHS2_PARRC::SspB (pBS1043)
Plasmid#185290PurposeFor the mammalian expression of the tardigrade protein CAHS2_PARRC attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertCAHS2_PARRC
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLPS1-FUSN:SspB (pBS1041)
Plasmid#185288PurposeFor the mammalian expression of the human protein FUSN attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertFUSN
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
HT114_Fsyn_FAS(Cre off)_QuasAr6b_Citrine
Plasmid#178825PurposeNeuronal expression (Cre-off) of an archaerhodopsin-derived genetically encoded voltage indicator QuasAr6b carrying a Citrine expression tagDepositorInsertQuasAr6b_citrine
UseCre/Lox and LentiviralTagscitrineExpressionMammalianMutationPromoterhSynAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
3020_pETcon-SARS-CoV-2-RBD_N501Y
Plasmid#184405Purposeyeast surface display of the SARS-CoV-2 Alpha variant RBDDepositorInsertSARS-CoV-2 Alpha Spike receptor binding domain (RBD) (S SARS-CoV-2 virus)
UseTagsHA and c-MycExpressionYeastMutationN501YPromoterAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-lambdaN-HA-DmNot4-dsRNAres_Q
Plasmid#147340PurposeInsect Expression of DmNot4-dsRNAresDepositorInsertDmNot4-dsRNAres (CG31716 Fly)
UseTagsExpressionInsectMutation7 silent mutations and 6 non silent mutations G20…PromoterAvailable sinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPM1cdN243-C1
Plasmid#131838PurposeExpresses the last 50 amino acids of HcRed-NPM1c (cytoplasmic mutant, human) in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
UseTagsHcRedExpressionMammalianMutationThis is a deletion contruct of the cytoplasmic m…PromoterAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHcRed-NPMMLF1nes-C1
Plasmid#131849PurposeExpresses the N-terminal nuclear export signal of HcRed-NPMMLF1 in mammalian cells through transient transfectionDepositorInsertNPM1 (NPM1 Human)
UseTagsHcRedExpressionMammalianMutationThis is a control deletion contruct of the cytop…PromoterAvailable sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pESC-LEU-IpgD(C439S)
Plasmid#183673PurposeInducible Shigella flexneri IpgD (catalytically inactive) for expression in yeastDepositorInsertIpgD
UseTagsExpressionYeastMutationC439SPromoterGAL1Available sinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40-Arg57Ala
Plasmid#180759PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 mutant Arg57Ala (residues 1-327)DepositorInsertα-COPI-WD40-Arg57Ala
UseTagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Arg57Ala, Leu1…PromoterCMVAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40-Tyr139Ala
Plasmid#180761PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 mutant Tyr139Ala (residues 1-327)DepositorInsertα-COPI-WD40-Tyr139Ala
UseTagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Tyr139Ala, Leu…PromoterCMVAvailable sinceMarch 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-α-COPI-WD40-Asp115Ala
Plasmid#180760PurposeMammalian expression plasmid for Schizosaccharomyces pombe α-COPI-WD40 mutant Asp115Ala (residues 1-327)DepositorInsertα-COPI-WD40-Asp115Ala
UseTagsC-terminal strep tagExpressionMammalianMutationEncodes residues 1-327; mutations: Asp115Ala, Leu…PromoterCMVAvailable sinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP-SPN_ARR Q37A/R38A/N52R (Shank3)
Plasmid#175256PurposeSPN-ARR fragment with structure opening N52R and actin binding site Q37A/R38A mutations in EGFP backbone for mammalian expressionDepositorInsertSPN-ARR fragment with Q37A/R38A/N52R mutations from SHANK3
UseTagsExpressionMammalianMutationPromoterAvailable sinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] K683E, H685E, K686E-Ss(424)
Plasmid#166855PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in K683E, H685E, K686E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationK683E, H685E, K686EPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641E, I645E-Ss(424)
Plasmid#166854PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641E, I645E with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641E, I645EPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCu-His6-Atg13[571–700] F641G, I645G-Ss(424)
Plasmid#166853PurposeExpresses 6xHis tagged ATG13 [571–700] fragment mutated in F641G, I645G with 14 scramble amino acid sequence DIKLIDTVDLESCN under a Cu promoter in yeastDepositorInsertAtg13[571–700] (ATG13 Budding Yeast)
UseTags6xHisExpressionYeastMutationF641G, I645GPromoterpCuAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsHaloExpressionMutationSFPQ-Y527APromotereF1aAvailable sinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
UbC-Halo-SFPQY527A
Plasmid#166947PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the UbC promoterDepositorInsertSFPQ-Y527A (SFPQ Human)
UseLentiviralTagsHaloExpressionMutationSFPQ-Y527APromoterUbCAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
T7pr-His6-MBP-TEV-Cas9-BirA*
Plasmid#159993PurposeBacterial expression of Cas9-BirA*DepositorInsertCas9-BirA*
UseTags6X-His, MBP, 3X-FLAG, NLSExpressionBacterialMutationD10A, H840APromoterT7Available sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-BcRF1-ORF24-2xStrep
Plasmid#138454PurposeExpresses BcRF1-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorUseTagsStrepExpressionMammalianMutationBcRF1 amino acids 1-178 fused to ORF24 amino acid…PromoterCMVAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-UL87-ORF24-2xStrep
Plasmid#138455PurposeExpresses UL87-ORF24 chimera with a C-terminal 2xStrep tag in mammalian cellsDepositorUseTagsStrepExpressionMammalianMutationUL87 amino acids 1-248 fused to ORF24 amino acids…PromoterCMVAvailable sinceOct. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307Y-pKK223
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
UseTagsExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
UseTagsExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
UseTagsExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
UseTagsExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable sinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 NPm
Plasmid#126593PurposeExpresses siRNA resistant SENP2 (nuclear pore mutant) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationDeletion of amino acids 1-65 and L329A/L331A in t…PromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
FLAG-SENP2 CCm
Plasmid#126594PurposeExpresses siRNA resistant SENP2 (coiled-coil deletion) in mammalian cells, Dox inducible in TetR cell linesDepositorInsertSENP2 (SENP2 Human)
UseTagsFLAGExpressionMammalianMutationDeletion of amino acids 203-228 and siRNA resista…PromoterCMVAvailable sinceOct. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF1a-3NLS-Klf4 TALE-GCN4
Plasmid#120546PurposeExpress 3xNLS-Klf4 TALE-GCN4 engineered to bind a site in the human KLF4 geneDepositorInsertNLS, Klf4 TALE, GCN4 (KLF4 Synthetic)
UseLentiviralTagsExpressionMammalianMutationPromoterEF1αAvailable sinceApril 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSlick-Neo-KANK1
Plasmid#121983PurposeTetracycline-inducible expression of untagged full-length KANK1DepositorInsertKANK1 (KANK1 Human)
UseLentiviralTagsExpressionMutationPromoterTight TRE promoterAvailable sinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shGBP1.2.mKO2
Plasmid#85210PurposeTRCN0000116120 (Target TGAGACGACGAAAGGCATGTA) for silencing GBP1 gene and express monomeric Kusabira-Orange2.DepositorInsertGBP1 (guanylate binding protein 1) (GBP1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCDX2 ObLiGaRe Donor vector/EPB64
Plasmid#90017PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to CDX2 exon1 locusDepositorInsertMCS flanked by inverted CDX2 ZFN binding sites (CDX2 Human)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLPC-NMYC-mTRF1deltaBLM
Plasmid#64163PurposeRetroviral vector expressing mouse TRF1 lacking BLM-binding motifs with N-terminal Myc tagDepositorInsertmTRF1 (Terf1 Mouse)
UseRetroviralTagsMycExpressionMammalianMutationDeleted amino acids 313-316 and 339-342 (both BLM…PromoterCMVAvailable sinceAug. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
SLP2a-TIR-GFP
Plasmid#52738PurposeRetroviral vector expresses the lipid binding domain of SLP2a fused to the TIR of hTIRAP and GFP. Also contains IRES-hCD2 as selectable markerDepositorInsertToll/IL-1 Receptor adaptor protein (TIRAP Human)
UseRetroviralTagsC2A domain of Murine SLP2a and GFPExpressionMammalianMutationDeleted amino acids 1-85PromoterAvailable sinceJune 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-HyPer7-MEM
Plasmid#136465PurposeMammalian expression of cytosolic side of plasma membrane targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsFarnselation tagExpressionMammalianMutationPromoterCMVAvailable sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+MLS-HyPer7
Plasmid#136470PurposeMammalian expression of mitochondrial matrix targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsTandem mitochondrial targeting signal of cytochro…ExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NES
Plasmid#136467PurposeMammalian expression of cytoplasm targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsNuclear export signal from the HIV Rev proteinExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTwist-SARS-CoV-2 Spike-deltaC18 JN.1.11.1
Plasmid#223272PurposeEncodes SARS-CoV-2 spike JN.1.11.1 for pseudovirus productionDepositorInsertSARS-CoV-2 Spike JN.1.11.1 (S Severe acute respiratory syndrome coronavirus 2)
UseTagsExpressionMammalianMutationSee Depositor Comments.PromoterCAGAvailable sinceSept. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianMutationPromoterCMV, SP6Available sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-TRE-Cas9- puro-polyA-CAG-rtTA
Plasmid#107270PurposeExpresses Cas9 upon induction with doxicycline.DepositorInsertshSpCas9
rtTA
bGH polyA-SV40polyA
UseTags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianMutationPromoterCAG and TREAvailable sinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PDi-CRISPRn
Plasmid#73500PurposeDox-inducible CRISPR nuclease (CRISPRn) knock in construct into the AAVS1 locusDepositorInsertsCas9
rtTA
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationPromoterCAG and TREAvailable sinceDec. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
-
pEGFP-C1-AR V7
Plasmid#86856PurposeFluorescent human androgen-receptor splice variant 7, lacking the ligand-binding domain (fused to EGFP)DepositorInsertAndrogen receptor (AR) (AR Human)
UseTagsEGFPExpressionMammalianMutationAlternative splice variant 7 (alteration/deletion…PromoterCMVAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+IMS-HyPer7
Plasmid#136469PurposeMammalian expression of mitochondrial intermembrane space targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsSMAC/DIABLOExpressionMammalianMutationPromoterCMV, SP6Available sinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
METTL3 shRNA 1 tet pLKO puro
Plasmid#162985PurposeTet-inducible shRNA targeting human METTL3 #1DepositorInsertmethyltransferase like 3 (METTL3 Human)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-TetO-hNGN2-Puro
Plasmid#79049PurposeExpresses human NEUROGENIN2 (hNGN2) and puromycin resistance gene under control of TetON promoter. This lentiviral vector is used to generate NGN2-iNs (induced neurons) from hiPSCs and hiPSC-NPCs.DepositorInserthNGN2-P2A-PuroR (NEUROG2 Human)
UseLentiviralTagsExpressionMutationPromoterTetOAvailable sinceJuly 21, 2016AvailabilityAcademic Institutions and Nonprofits only