169,450 results
-
Plasmid#79754PurposeSingle fluorescent protein biosensor for trehaloseDepositorInsertTre-C04
Tags6xHisExpressionBacterialPromoterpTrcAvailable SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
piggyBac-rtTA (4th_Gen)-NGN2-2A-PURO-IRES-SNAP (VK_1018)
Plasmid#209077PurposeNgn2 mediated cortical neuron induction, dox induction is includedDepositorAvailable SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
GPR116-Tango
Plasmid#66307PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR_MFE1_hrGFP
Plasmid#84617PurposeHR donor to integrate UAS1B8TEF(136)-hrGFP-CYC1t into MFE1 locusDepositorInserthrGFP
UseSynthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLX401-INK4A
Plasmid#121919PurposeDoxycycline-inducible expression of p16-INK4A product of CDKN2ADepositorAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTALdNC-AAVS1_T1
Plasmid#80495PurposeAAVS1 TALEN expression vector (Left)DepositorInsertAAVS1 TALEN (Left)
UseGateway entryPromoternoneAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTALdNC-AAVS1_T2
Plasmid#80496PurposeAAVS1 TALEN expression vector (Right)DepositorInsertAAVS1 TALEN (Right)
UseGateway entryPromoternoneAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMC-6-BeYDV-Rep-RepA-9
Plasmid#197715PurposePhytobrick (MoClo) Level 0 PartDepositorInsertBeYDV Rep/RepA proteins: native ORFs
ExpressionPlantAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV[Expression]-mCherry:T2A:Hygro-EF1A>Luc2
Plasmid#174665PurposeExpresses humanized firefly luciferase and mCherry and Hygromycin resistance linked by T2A, each controlled by a strong promoterDepositorInsertsLUC2
mCherry:T2A:Hygro
UseLentiviral and LuciferaseTagsmCherry and hygromycin dual reporter gene linked …ExpressionMammalianPromoterHuman cytomegalovirus immediate early enhancer/pr…Available SinceOct. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti_gRNA-Puro
Plasmid#84752PurposeExpresses Cpf1 customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBT13-splitD
Plasmid#122597Purposeclone M13 phage by SapI Golden GateDepositorInsertM13 bacteriophage genes
ExpressionBacterialAvailable SinceJuly 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Neo DEST (705-1)
Plasmid#17392Purpose3rd gen lentiviral Gateway destination vector, expression, CMV promoter, NeoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Destination vectorExpressionMammalianAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
2333_Cas9-CtIP-dnRNF168
Plasmid#200254PurposeThis plasmid expresses the Cas9-CtIP-dnRNF168 in mammalian cellsDepositorInsertCas9-CtIP-dnRNF168
ExpressionMammalianPromoterCMVAvailable SinceJune 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
GFP-Rab27B
Plasmid#89447PurposeExpression of GFP-tagged human Rab27B in mammalian cellsDepositorAvailable SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTmpl-miniDonor-GFP
Plasmid#238107PurposeMini donor expressing GFP, used for PCR to generate IVT template.DepositorInsertCMV-GFP-syntheticPA flanked by R2Tg UTRs and 28S sequence
ExpressionMammalianAvailable SinceJuly 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICOZ-MAG[EF1α-CD19 4-1BB-eGFP]
Plasmid#218344PurposeDonor plasmid of MAG Transposon with CD19 CAR mammalian expression cassetteDepositorInsertCD19 CAR mammalian expression cassette
UseLentiviralExpressionMammalianAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_SLC16A3
Plasmid#131899PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertSLC16A3 (SLC16A3 Human)
ExpressionMammalianAvailable SinceOct. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
EasyClone-MarkerFree Vector Set
Plasmid Kit#1000000098PurposeYeast (S. cerevisiae) vector toolkit for marker-less integration of genes into 11 predetermined EasyClone Chromosomal loci via CRISPR-Cas9DepositorAvailable SinceDec. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_D17
Plasmid#84611PurposeIntroduces DSB at D17 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceDec. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET296-YcpLac111 CYC1p-MCP-NLS-2xyeGFP
Plasmid#104394PurposeYeast MCP-GFP expressionDepositorInsertMCP-NLS-2xyeGFP
ExpressionBacterial and YeastMutationMCP fused to NLS(SV40) and 2x yeast codon optimiz…PromoterCYC1Available SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC mTagBFP2
Plasmid#191566PurposeExpresses an shRNA and mTagBFP2DepositorTypeEmpty backboneUseLentiviral and RNAiExpressionMammalianPromoterU6 for shRNAAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV h c-MYC IRES GFP
Plasmid#18119DepositorInsertc-MYC (MYC Human)
UseRetroviralTagsGFPMutationThe CUG which is the start site for Myc I is pres…Available SinceJune 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFPC1-human APPL1
Plasmid#22198DepositorInsertAdaptor protein containing PH domain, PTB domain and Leucine zipper motif (APPL1 Human)
TagsGFPExpressionBacterial and MammalianAvailable SinceOct. 21, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSG5-mCALEBlong (aa 1-566)
Plasmid#89399Purposemammalian expression of mouse CSPG5 long isoformDepositorAvailable SinceJuly 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNP3254 [pNP2922 - ISCro4 Enhanced DBL (DBL3, WT) + ISCro4 Recombianse (WT]
Plasmid#247257PurposeExpress ISCro4 recombinase and bridge RNADepositorInsertpNP2922 - ISCro4 bRNA101-179 ins179(rc(101-111) (DBL3)
ExpressionMammalianMutationins179(rc(101-111)Available SinceOct. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYTK072
Plasmid#65179PurposeEncodes ConRE as a Type 5 part to be used in the Dueber YTK systemDepositorInsertConRE
ExpressionBacterialAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEF1-alpha-V
Plasmid#27290DepositorAvailable SinceMarch 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
AAV-EF1a-DIO-oChIEF(E163A/T199C)-P2A-dTomato-WPRE-BGHpA
Plasmid#51094PurposeCre dependent expression of oChIEF kinetic variant E163A/T199C with physically uncoupled dTomato fluorophoreDepositorInsertoChIEF(E163A/T199C)
UseAAVTagsP2A-dTomatoExpressionMammalianMutationE163A/T199CPromoterEF1aAvailable SinceMay 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
BL21(DE3) ΔserC
Bacterial Strain#197656PurposeDerivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine.DepositorBacterial ResistanceNoneAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA flag PPAR gamma
Plasmid#8895PurposeMammalian expression of flag-tagged PPAR gammaDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV9.452sub.LUNG1
Plasmid#184592Purposenon-standard AAV2 rep-AAV9.452sub.LUNG1 cap plasmid with AAV cap expression controlled by a tTA-TRE amplification system for mouse lung transduction after intravenous injectionDepositorInsertSynthetic construct isolate AAV9.452sub.LUNG1 VP1 gene
UseAAVExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available SinceJuly 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUbC-OsTIR1-myc-IRES-scFv-sfGFP
Plasmid#84563PurposeBicistronic vector for expression of O. sativa E3 ubiquitin ligase and single chain variable fragment of GCN4 antibody fused to superfolder GFPDepositorInsertTransport inhibitor response 1 (E3 ligase domain), IRES, single chain variable fragment-superfolder GFP
UseLentiviralTagsmyc tag (9x)Available SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3-HA PSPC1
Plasmid#101764PurposeExpresses PSPC1 in mammalian cellsDepositorAvailable SinceOct. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
ABE8.20-m
Plasmid#136300Purposeexpresses ABE8.20-m in mammalian cellsDepositorInsertABE8.20-m
TagsC-terminal BPNLSExpressionMammalianMutationD10A in S. pyogenes Cas9, TadA mutations describe…Available SinceMarch 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFlare9A-Dup34
Plasmid#90267PurposeMinigene reporter for alternative splicing analysisDepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-RfxCas13d-Blast-BFP
Plasmid#196726PurposeSortable and selectable RfxCas13d.DepositorInsertRfxCas13d-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsSV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRyl_MFE1
Plasmid#84612PurposeIntroduces DSB at MFE1 locus in Y. lipolyticaDepositorInsertCas9
UseCRISPR and Synthetic BiologyExpressionYeastPromoterUAS1B8-TEF(136)Available SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mDlx-GCaMP6f-Fishell-2 (AAV9)
Viral Prep#83899-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-mDlx-GCaMP6f-Fishell-2 (#83899). In addition to the viral particles, you will also receive purified pAAV-mDlx-GCaMP6f-Fishell-2 plasmid DNA. mDlx-driven expression of GCaMP6f. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable SinceNov. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a T7pCONS TIR-2 sfGFP
Plasmid#154464PurposepET28a with a design flaw in the T7 promoter fixed, and a synthetically evolved TIR. Contains the coding sequence for sfGFPDepositorInsertsuper folder GFP
TagsHis-thrombinExpressionBacterialPromoterT7Available SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only