175,750 results
-
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-SMN
Plasmid#37057DepositorAvailable SinceFeb. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
Plasmid#118156PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-EGFP under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterEF1a core and U6Available SinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBluescript II NLS-MC-EGFP-tdTomato (pBET2)
Plasmid#240411PurposeThis plasmid facilitates the assessment of MMR proficiency in human living cellsDepositorInsertNLS-EGFP fusion protein
ExpressionMammalianPromoterCMVAvailable SinceSept. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
7TGP
Plasmid#24305DepositorInsert7xTcf-eGFP // SV40-PuroR
UseLentiviralMutationEGFP is GFP with S65T and F64L mutationsAvailable SinceApril 5, 2010AvailabilityAcademic Institutions and Nonprofits only -
VPS29-YFP
Plasmid#174520PurposeExpresses human VPS29 with a C-terminal YFP in mammalian cellsDepositorAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBAD-Ag43
Plasmid#107743PurposeExpresses Ag43 under the control of an L-arabinose transcriptional regulatorDepositorInsertAg43 (flu )
ExpressionBacterialMutationremoved all pstI cut sites with silent mutations,…PromoterpBADAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-HO-G
Plasmid#164163PurposeExpresses mEGFP (monomeric EGFP with the A206K mutation) under the control of CAG promoter, codon-optimized for Homo sapiens, basic vector, multiclonig site at C terminalDepositorInsertmEGFP A236K
ExpressionMammalianPromoterCAGAvailable SinceFeb. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7f-WPRE (AAV Retrograde)
Viral Prep#104488-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-jGCaMP7f-WPRE (#104488). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7f-WPRE plasmid DNA. Synapsin-driven GCaMP7f calcium sensor. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJet1.2 ermB cassette
Plasmid#117121PurposeErythromycin resistance cassetteDepositorInsertErythromycin resistance cassette for Bacillus subtilis selection
UseGolden gate donor vector for gene targeting in ba…Available SinceNov. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-rDA3h-IRES-EGFP-CAAX
Plasmid#208697PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_rDA3h and a membrane-localized EGFP in mammalian cellsDepositorInsertGPCR activation based dopamine (DA) sensor GRAB_rDA3h
ExpressionMammalianPromoterCMVAvailable SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1_MeCP2(WT)
Plasmid#110186PurposeExpression of mouse MeCP2 (WT) in mammalian cellsDepositorInsertMeCP2_e2 FL (mouse cDNA) (Mecp2 Mouse)
TagsEGFPExpressionMammalianMutationwild typePromoterCMVAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gai2
Plasmid#196049PurposeEncodes a G alpha subunit (GNAl2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
ALIX-mNeonGreen
Plasmid#191191PurposeFull-length ALIX with C-terminal mNeonGreen tag.DepositorAvailable SinceOct. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lck-mTurquoise2
Plasmid#98822PurposeIn vivo visualization of the plasma membrane (can be used for colocalization studies)DepositorInsertLck
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-FGFR3-S249C
Plasmid#116386PurposeLentiviral expression of FGFR3 S249CDepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLENTI_RPS3_Keima
Plasmid#127140DepositorInsertRPS3_Keima (RPS3 Human)
UseLentiviralAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF0727
Plasmid#141674PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV_[Exp]-Hygro-EF1A-FUCCIplex
Plasmid#240160PurposeMultiplexable FUCCI sensor (FUCCIplex). The EF1α promoter drives the expression of the fluorescent sensor.DepositorInsertFUCCIplex
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterEF1AAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pR26 GFP Dest
Plasmid#74283PurposeGene targeting vector for the mouse Rosa26 locus, including a loxP flanked stop cassette and GFP, for gateway cloningDepositorInsertRosa26 5-homology region
Available SinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 mycBioID
Plasmid#35700PurposeTo fuse your protein of interest to the C-terminus of BirA(R118G) and use in proximity-dependent biotin identification (BioID); myc tagDepositorHas ServiceCloning Grade DNAInsertBirA
TagsMycExpressionMammalianMutationR118G (highly promiscuous form)PromotercmvAvailable SinceApril 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pET-NDH6
Plasmid#105503PurposeExpression of an N-terminally truncated form of Drosophila topoisomerase I with a C-terminal 6His tagDepositorInsertNDH6
Tags6xHisAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pC015 - dLwCas13a-NF
Plasmid#91905PurposeExpresses negative-feedback dLwCas13a for mammalian RNA targeting/imagingDepositorInsertdLwCas13a
UseCRISPRTagsNLS and eGFP, ZF CCR5TC, KRAB-A, NLSExpressionMammalianMutationR474A and R1046APromoterCAGAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTO149_RFP_CauNEO
Plasmid#177277PurposeEncodes a G418 (NEOr) selectable marker with codon-optimization for expression in CUG clade fungi. Also encodes RFP tagging of Candida auris ENO1 to measure transformation efficiency.DepositorInsertRFP, CauNEO
TagsENO1-RFPExpressionBacterialMutationAll CUG Leucine codons were replaced with the syn…PromoterAgTEF2Available SinceNov. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV(cmv)-NEO-FSF-tdTomato Cre reporter
Plasmid#160551Purposelabeling hypoxic cells, Cre reporterDepositorInserttdTomato
UseLentiviralPromoterCMVAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
tdTomato-VE-Cadherin-N-10
Plasmid#58142PurposeLocalization: Tight Junctions, Excitation: 554, Emission: 581DepositorInsertVE-Cadherin (CDH5 Human)
TagstdTomatoExpressionMammalianMutationI503T in VE-CadherinPromoterCMVAvailable SinceNov. 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
Factor IX donor
Plasmid#182141PurposeFactor IX donor for twinPE and Bxb1 mediated insertion at ALBDepositorInsertattP-Factor IX intron 1 and exon 2-8 CDS and exon 8 3'UTR
ExpressionMammalianAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS426 Gal TDP43 GFP
Plasmid#27467DepositorAvailable SinceFeb. 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pUC18T-mini-Tn7T-Gm-Pc-sfGFP
Plasmid#199248PurposeFluorescent labelling of bacterial cells with sfGFPDepositorInsertCodon-optimized sfGFP gene
ExpressionBacterialMutationCodon optimization for XanthomonadaceaePromoterPc promoter from class III integron of Delftia a…Available SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pERB264
Plasmid#67764PurposeTags peroxisomes with GFP and HalotagDepositorInsertPEX3-GFP-Halo
TagsGFP and HalotagExpressionMammalianAvailable SinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMma PylT_FLAG-Mma PylRS AF
Plasmid#140023PurposePlasmid with 4xMmaPylT cassette and MmaPylRS AF for amber suppression; for transient or stable piggyBac-mediated integrationDepositorInsertMma PylRS (pylS Methanosarcina mazei)
TagsFLAGExpressionMammalianMutationY271A, Y349FPromoterEF1Available SinceMay 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiLox7.0-mVenus-CAGEn (Nrdj1)
Plasmid#241404PurposeProximity-triggered Protein Trans-Splicing between mVenus and RFP, Figure 1 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertmVenus-CAGEn (Nrdj1)
UseLentiviralTags3xFLAGExpressionMammalianPromoterCMVAvailable SinceDec. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiLox7.0-CAGEc-RFP (Nrdj1)
Plasmid#241402PurposeProximity-triggered Protein Trans-Splicing between mVenus and RFP, Figure 1 in Nature Chemical Biology 20.10 (2024): 1353-1360.DepositorInsertCAGEc-RFP (Nrdj1)
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceOct. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
hCRISPRa-v2, genome-wide, 10 sgRNAs/gene
Pooled Library#1000000091PurposeGenome-wide CRISPR gRNA pooled library for activation of human genesDepositorAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.3_SARS2_XBB.1.5
Plasmid#196585Purposeexpressing SARS-CoV-2 XBB.1.5 spike protein for pseudovirus productionDepositorInsertSpike (XBB.1.5)
ExpressionMammalianMutationG252V, F486P on the basis of XBBPromoterCMVAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
NLS-Laconic/pCMV-myc-nuc
Plasmid#46307Purposea nuclear-targeted, genetically-encoded sensor for lactateDepositorInsertNLS-Laconic
UseLactate biosensorExpressionMammalianPromoterCMVAvailable SinceAug. 2, 2013AvailabilityAcademic Institutions and Nonprofits only -
FLAG-EglN3-pLenti6
Plasmid#36951DepositorInsertEglN3 (EGLN3 Human)
UseLentiviralTagsFLAGExpressionMammalianMutationWildtypePromoterCMVAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only