We narrowed to 11,193 results for: ENA
-
Plasmid#231988PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCSN067
Plasmid#101748PurposeSingle copy yeast plasmid expressing Cpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsCpf1 from Lachnospiraceae bacterium ND2006 (LbCpf1) codon optimized for expression in S. cerevisiae.
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
AA183
Plasmid#216025PurposeFragmid fragment: (Cas protein) for prime editing; R221K;N394K for increased efficiencyDepositorHas ServiceCloning Grade DNAInsertnCas9 (H840A)_v2.1 [Sp]
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7f-5p
Plasmid#103156PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7f-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7f-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_MED13
Plasmid#111689PurposeMAC-tagged gene expressionDepositorInsertMED13 (MED13 Human)
ExpressionMammalianAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2-IRES-dOrai-IRES-mCherry
Plasmid#72894PurposeMammalian expression of dmBACCS2, a Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pXW109Hg(RS-RinA-E11)2
Plasmid#123151PurposeMercury sensor with three-layered amplifier cascade. Need to work with plasmid pXWP11-gfp2. pSB4A3 carrying J109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-tDepositorInsertJ109-32merR-t-PmerT-30hrpR-30hrpS-t-PhrpLE-30RinA(ASV)-t-PrinA-33ECF11-t
UseSynthetic BiologyExpressionBacterialPromoterJ109, PmerT, PhrpLE, PrinAAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMIR-DsRed-IRES-His-Halo-Tev-Keap1
Plasmid#58240Purposeexpresses halo tagged human Keap1 proteinDepositorInsertKelch like ECH associated protein 1 (KEAP1 Human)
TagsHis-Halo-TevExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC49-puro
Plasmid#231989PurposeKnockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne2 (OTU+UBA, aa 1-462)
Plasmid#61582PurposeExpresses human Cezanne2 (OTU+UBA domains) in E. coli.DepositorInsertCezanne2 (OTUD7A Human)
TagsHis6-GST-3CExpressionBacterialMutationIsoform 2. Deleted aa 463-933.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
plenti-UbcP-FLAG-CRBN-pGK-HYG
Plasmid#107374PurposeLentiviral expression of FLAG-CRBNDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Flag-cMyc T58A
Plasmid#20076DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
TRAV25
Plasmid#237982PurposeEncodes TRAV25 allele, P2A, and TRBC to generate TCRs via cloningDepositorAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEX-DAXX-ΔD/E-His
Plasmid#179618PurposeExpress GST-DAXX-ΔDE-His in bacteriaDepositorInsertdeath domain associated protein (DAXX Human)
TagsHisExpressionBacterialMutationdeleted amino acids 424-495Available SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HaloAKAR2.1-NES-T2A-EGFP-CAAX
Plasmid#216491PurposeExpression of chemigenetic PKA biosensor (medium basal brightness, high dynamic range) and PM targeted EGFP in mammalian cellsDepositorInsertHaloAKAR2.1
TagsNES, T2A-EGFP-CAAXExpressionMammalianPromoterCMVAvailable SinceJune 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDEST47-CYFIP1.GFP
Plasmid#109139PurposeGFP-tagged CYFIP1 expression constructDepositorAvailable SinceFeb. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGEX-DAXX-D/E-His
Plasmid#179619PurposeExpress DAXX D/E region in bacteriaDepositorInsertdeath domain associated protein (DAXX Human)
TagsGST, His, and TEVExpressionBacterialMutationamino acids 414-505 of DAXXAvailable SinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAN056
Plasmid#220052PurposeReporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (positive control).DepositorInsertfLuc-CFTR (exons 22-27) (CFTR Human)
ExpressionMammalianAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN057
Plasmid#220053PurposeNMD-reporter plasmid that expresses a a firefly luciferase gene fused to exons 22-27 of the CFTR gene and a synthetic intron (c.3846G>A mutation; W1282X).DepositorAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
R4pGWB601_UBQ10p-miniTurbo-NES-YFP
Plasmid#127369PurposeBinary vector for expressing cytosolic miniTurbo-YFP under the UBQ10 promoter in plantsDepositorInsertminiTurbo (BirA mutant)
TagsGS linker, NES, V5, and YFPExpressionPlantMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …PromoterArabidopsis UBQ10 promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRBV6-4
Plasmid#237916PurposeEncodes TRBV6-4 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRBV27
Plasmid#237947PurposeEncodes TRBV27 allele and TRAC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRAV19
Plasmid#237976PurposeEncodes TRAV19 allele, P2A, and TRBC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRAV12-2
Plasmid#237968PurposeEncodes TRAV12-2 allele, P2A, and TRBC to generate TCRs via cloningDepositorAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-eGFP-attP(bxb)-*BsdR
Plasmid#183751PurposeBxb1 landing pad cassette.DepositorInsertloxP-eGFP-attP-Bsd-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hSox2
Plasmid#20073DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-Turbo-NES-mVenus-STOP-L3
Plasmid#127353Purposegateway entry vector for making C-terminal TurboID-mVenus fusion with non-nuclear proteinsDepositorInsertTurboID (BirA mutant)
UseGateway entry vectorTagsGS linker, NES, V5, and mVenusMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2*
Plasmid#169850PurposeMammalian Expression, SpyCas9 prime editor, optimized NLSDepositorInsertspCas9 PE*
TagsbpSV40 NLS and SV40 NLS and cmyc-NLS and bpSV40 N…ExpressionMammalianPromotercmvAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-YFP-CAAX-IRES*-GINIP-Nluc
Plasmid#223559PurposeAlias: Gαi bONE-GO. Lentiviral vector expressing GINIP-Nluc after a low efficiency IRES downstream of YFP-CAAX placed after the promotorDepositorInsertYFP(Venus) - KRas4b - IRES* - human GINIP - linker(GGGS) - Nluc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA3.0-TRPV4-p2A-ferritin-p2A-mCherry
Plasmid#74309PurposeTricistronic expression of TRPV4, ferritin, and mCherry in mammalian cellsDepositorInsertTRPV4-p2A-ferritin-p2A-mCherry (Trpv4 Human, Rat)
TagsFLAGExpressionMammalianPromoterCMVAvailable SinceJuly 18, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-P3-IgKL-mNG
Plasmid#183465PurposeTo produce AAV with the P3 promoter to express IgkL-mNeonGreen (IgKL is a secretory signal peptide)DepositorInsertIgKL-mNeonGreen
UseAAVTagsIgKL secretory signalAvailable SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_ccdB_lox
Plasmid#183763PurposeBxb1-specific donor plasmid for the cloning of multiple inserts by Golden Gate assembly (BpiI)DepositorInsertccdB
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherry
Plasmid#35500PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GST-DAXX-His
Plasmid#175781PurposeDAXX protein for baculovirus expression systemDepositorAvailable SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHD-SPARC2-S-LexA::p65
Plasmid#133564PurposeSwap out effector and terminator to generate SPARC2-S CRISPR-donor vector for CRISPR-HDR genomic insertion near the attP40 locusDepositorInsertLexA::p65
UseCRISPRExpressionInsectPromoter20X UASAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMGS56 (GFP-ARF16-PB1-P2A-OsTIR1)
Plasmid#129668PurposeA repair construct to express GFP-ARF16-PB1 and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hKlf4
Plasmid#20074DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pBabe-puro-mRipk3
Plasmid#78830Purposeretroviral expression of mRIPK3DepositorAvailable SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pW5Y_Apr
Plasmid#158211PurposeBAC-based, lacUV5 regulon and Cre recombinase in loxP and lox5171 sitesDepositorTypeEmpty backboneAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.1.t1
Plasmid#73545PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.1.t1
pAcFRS.1.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pECE M2-SH3PXD2A WT
Plasmid#69813PurposeExpresses M2-SH3PXD2A in mammalian cellsDepositorInsertSH3 and PX domain-containing protein 2A (SH3PXD2A Human)
TagsFLAGExpressionMammalianPromoterSV40 early promoterAvailable SinceMay 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBC2T-LC3B
Plasmid#112026Purposeexpresses BC2-tag-LC3B in mammalian cellsDepositorAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
MAC_C_AIFM1
Plasmid#111659PurposeMAC-tagged gene expressionDepositorInsertAIFM1 (AIFM1 Human)
ExpressionMammalianAvailable SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-miniTurbo-NES-mVenus-STOP-L3
Plasmid#127355Purposegateway entry vector for making C-terminal miniTurbo-mVenus fusion with non-nuclear proteinsDepositorInsertminiTurbo (BirA mutant)
UseGateway entry vectorTagsGS linker, NES, V5, and mVenusMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-EF1A>Tet3G
Plasmid#184379PurposeThe Tet3G gene is expressed under a constitutive EF1-alpha promoter. This protein binds a TRE3G promoter to activate gene transcription only in the presence of tetracycline or its analogs (e.g. doxycycline)DepositorInsertTet3G
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2.1 (pAGL2A)
Plasmid#27563DepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
Plasmid#35501PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only