We narrowed to 11,370 results for: ENA
-
Plasmid#188631PurposeHuman Grb2 C-terminally labeled with TagBFPDepositorAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pET-NlaCascade-NLS-6xHis
Plasmid#180213PurposeExpressing Neisseria lactamica Type I-C Cascade subunits (Cas5-Cas8-Cas11-Cas7) with NLS and His tag on the C terminus of Cas7 for protein purification in E.ColiDepositorInsertNlaCas5-Cas8-Cas7
Tags6XHis and NLSExpressionBacterialPromoterT7Available SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSF-MjCouRS
Plasmid#229066PurposetRNA synthetase/tRNA pair for the in vivo incorporation of (7-hydroxy-4-coumarin-yl) ethylglycine (Hco), into proteins in E. coli in response to the amber (TAG) codonDepositorInsertMethanococcus jannaschii tRNA synthetase
ExpressionBacterialPromoterT7Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
WDR5-HaloTag
Plasmid#200881PurposeMammalian expression of human WDR5 with C-terminal HaloTag fusionDepositorAvailable SinceMay 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMSCVpuro-Flag-cMyc T58A
Plasmid#20076DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCSN068
Plasmid#101749PurposeSingle copy yeast plasmid expressing Cpf1 from Francisella novicida U112 (FnCpf1), codon optimized for expression in Saccharomyces cerevisiae.DepositorInsertsCpf1 from Francisella novicida U112 (FnCpf1) codon optimized for expression in S. cerevisiae.
KanMX marker expression cassette.
UseCRISPRTagsSV40 NLSExpressionYeastPromoterHeterologous TEF1 promoter from A. gossypii. and …Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
SspB-iRFP-DHPH-TIAM1
Plasmid#176118PurposeHeterodimerization with iLID, Rac1 activationDepositorInsertTIAM1 (TIAM1 Human)
ExpressionMammalianAvailable SinceOct. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-M522K-peGFP-N1
Plasmid#228579PurposeExpresses mouse TMEM16F-M522K-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationM522K plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
dmBACCS2-IRES-dOrai-IRES-mCherry
Plasmid#72894PurposeMammalian expression of dmBACCS2, a Drosophila melanogaster blue light-activated Ca2+ channel switch, along with dOrai and mCherryDepositorInsertdmBACCS2-IRES-dOrai-IRES-mCherry
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceJan. 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEM-Cas9HF1
Plasmid#89961PurposeModified from pCas9-CR4 (Addgene: 62655) to use the high-fidelity version of Cas9, SpCas9-HF1 (N497A/R661A/Q695A/Q926A) from Kleinstiver et al 2016.DepositorInsertCas9HF1
ExpressionBacterialMutationN497A/R661A/Q695A/Q926APromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
LSB-hsa-let-7a-5p
Plasmid#103146PurposeUsed to sense miRNA activity using fluorescence based tools. hsa-let-7a-5p target in 3' UTR of of mKate. miRNA activity can be measured by the repression of mKate2 relative to EBFP2 fluorescent proteins . Plasmid is inherently unstable; please see Depositor CommentsDepositorInserthsa-let-7a-5p target
UseSynthetic BiologyExpressionMammalianPromoterEF-1aAvailable SinceNov. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hSox2
Plasmid#20073DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLV-mCherry-FKBP-TIAM1(DHPH)
Plasmid#176138PurposeHeterodimerization with FRB (rapamycin), Rac1 activationDepositorInsertTIAM1 (TIAM1 Human)
UseLentiviralAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGY416
Plasmid#166660PurposeFor light-inducible Cre recombinase (LiCre) expression under the Gal1 promoter in yeastDepositorInsertLiCre
UseCre/LoxExpressionYeastMutationCre: E340A, D341APromoterGAL1Available SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
TK-GFP-Nluc-P2A-neo-TK
Plasmid#134896PurposeExpresses GFP protein and a fusion protein of Nluc-neo inserting into Cryptosporidium parvum TK locusDepositorInsertTK-GFP-Nluc-P2A-Neo-TK
UseCryptosporidium expressionPromoterCryptosporidium actin and enolaseAvailable SinceNov. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEntr1a-mcherry-FKBP-TIAM1(DHPH)
Plasmid#176135PurposeHeterodimerization with FRB (rapamycin), Rac1 activationDepositorAvailable SinceOct. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
SpyCas9 PE2*
Plasmid#169850PurposeMammalian Expression, SpyCas9 prime editor, optimized NLSDepositorInsertspCas9 PE*
TagsbpSV40 NLS and SV40 NLS and cmyc-NLS and bpSV40 N…ExpressionMammalianPromotercmvAvailable SinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pENTR-eGFP-attP(bxb)-*BsdR
Plasmid#183751PurposeBxb1 landing pad cassette.DepositorInsertloxP-eGFP-attP-Bsd-lox251
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEntr1a-SspB-HaloTag-TIAM1-DHPH
Plasmid#176134PurposeHeterodimerization with iLID, Rac1 activationDepositorInsertTIAM1 (TIAM1 Human)
UseEntry vectorAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-C1V1 (t/t)-TS-mCherry
Plasmid#35500PurposeAAV expression of CaMKII-driven chimeric opsin variant C1V1 (E122T/E162T) for fast and potent optical excitation at red-shifted wavelengths.DepositorInsertChR1-VChR1 Chimera
UseAAVTagsmCherryExpressionMammalianMutationE122T and E162TPromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMIR-DsRed-IRES-His-Halo-Tev-Keap1
Plasmid#58240Purposeexpresses halo tagged human Keap1 proteinDepositorInsertKelch like ECH associated protein 1 (KEAP1 Human)
TagsHis-Halo-TevExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
hPlekhm1-dsRedM
Plasmid#73592PurposeExpress human Plekhm1 in mammalian cellsDepositorAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pASK-mSAN1-Streptag
Plasmid#117165PurposeExpresses Strep-tagged murine SAN1 nuclease in bacteriaDepositorAvailable SinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMGS56 (GFP-ARF16-PB1-P2A-OsTIR1)
Plasmid#129668PurposeA repair construct to express GFP-ARF16-PB1 and OsTIR1 under the control of the CMV promoter from the human AAVS1 locusDepositorInsertOsARF16-PB1 domain
TagsGFPExpressionMammalianAvailable SinceAug. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-Flag-hKlf4
Plasmid#20074DepositorAvailable SinceJan. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pHD-SPARC2-S-LexA::p65
Plasmid#133564PurposeSwap out effector and terminator to generate SPARC2-S CRISPR-donor vector for CRISPR-HDR genomic insertion near the attP40 locusDepositorInsertLexA::p65
UseCRISPRExpressionInsectPromoter20X UASAvailable SinceOct. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_ccdB_lox
Plasmid#183763PurposeBxb1-specific donor plasmid for the cloning of multiple inserts by Golden Gate assembly (BpiI)DepositorInsertccdB
UseCre/Lox and Synthetic BiologyExpressionMammalianAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-SpdCas9-W3SL
Plasmid#210708PurposeThis Plasmid express hSyn promoter driven SpdCas9DepositorInsertS. Pyogenes dCas9
UseAAV and CRISPRTagsFLAGExpressionMammalianMutationD10A/H840APromoterhSynAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.1.t1
Plasmid#73545PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.1.t1
pAcFRS.1.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcs2-HRI-GFP-IRES-mCherry
Plasmid#226099PurposeHRI stability reporter construct for transient expression in mammalian cellsDepositorAvailable SinceOct. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
MAC_N_AURKB
Plasmid#111682PurposeMAC-tagged gene expressionDepositorInsertAURKB (AURKB Human)
ExpressionMammalianAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOPINK-Cezanne2 (OTU+UBA, aa 1-462)
Plasmid#61582PurposeExpresses human Cezanne2 (OTU+UBA domains) in E. coli.DepositorInsertCezanne2 (OTUD7A Human)
TagsHis6-GST-3CExpressionBacterialMutationIsoform 2. Deleted aa 463-933.PromoterT7Available SinceMarch 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRExpressionMammalianAvailable SinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLV[Exp]-Neo-EF1A>Tet3G
Plasmid#184379PurposeThe Tet3G gene is expressed under a constitutive EF1-alpha promoter. This protein binds a TRE3G promoter to activate gene transcription only in the presence of tetracycline or its analogs (e.g. doxycycline)DepositorInsertTet3G
UseLentiviralAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(C128S/D156A)-EYFP
Plasmid#35501PurposeAAV expression of CaMKII-driven stabilized step function opsin (SSFO) for optogenetic activation.DepositorInserthChR2
UseAAVTagsEYFPExpressionMammalianMutationC128S and D156APromoterCaMKIIaAvailable SinceApril 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
FUW-TetO-Esrrb
Plasmid#40798DepositorAvailable SinceOct. 12, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCDNA-3xFLAG-NLS-TPP1
Plasmid#53585PurposeMammalian expression of 3xFLAG tagged, nuclear localized TPP1, N-terminal.DepositorInsertTPP1 (ACD Human)
Tags3xFLAG and NLSExpressionMammalianMutationSilent mutation to eliminate PacI sitePromoterCMVAvailable SinceJune 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR_P2R-P3_R2-miniTurbo-NES-mVenus-STOP-L3
Plasmid#127355Purposegateway entry vector for making C-terminal miniTurbo-mVenus fusion with non-nuclear proteinsDepositorInsertminiTurbo (BirA mutant)
UseGateway entry vectorTagsGS linker, NES, V5, and mVenusMutationaa1-63 deleted; Q65P, I87V, R118S, E140K, Q141R, …Promoterno promoterAvailable SinceSept. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C2200
Plasmid#91082PurposeModule C, Promoter: none – to be combined with gRNA array in module B, Gene: SapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers (only works with pMOD_B2203), Terminator: 35SDepositorInsertSapI ccdb cassette for cloning multiple gRNA spacers with Csy4 spacers
UseCRISPRPromoternone (will be fused to gRNA array in MODULE B)Available SinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
p2.1 (pAGL2A)
Plasmid#27563DepositorAvailable SinceOct. 19, 2011AvailabilityAcademic Institutions and Nonprofits only