We narrowed to 1,494 results for: U6 promoter
-
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only
-
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shEsco2
Plasmid#160957PurposeEsco2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBub1
Plasmid#160948PurposeBub1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdk1
Plasmid#160953PurposeCdk1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
c-JUN KO in LentiCRISPRv2GFP
Plasmid#254390PurposeExpress sgRNA targeting human c-JUNDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTJK689 (EPOR KO in LentiCRISPRv2GFP)
Plasmid#254393PurposeExpress sgRNA targeting human EPORDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K
Plasmid#187274PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPMutationAnillin A740D, E758KPromoterU6, 5'LTRAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdc20
Plasmid#160954PurposeCdc20 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shKif11
Plasmid#160962PurposeKif11 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shAspm
Plasmid#160947PurposeAspm shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdkn3
Plasmid#160955PurposeCdkn3 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCenpf
Plasmid#160956PurposeCenpf shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3_nsgRNA(PP7)
Plasmid#232444PurposensgRNA for PE3 facilitation of a +1 T to A prime edit on the HEK3 locus, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3) for HEK3+1t>a edit driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_empty-sgRNA(PP7)
Plasmid#232432Purposeempty gRNA backbone which contains the PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged sgRNA scaffold driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_pegRNA_(PP7-C4-Q1)
Plasmid#232433PurposepegRNA with optimized 3' modifications to correct the rd6 mutationDepositorInsert3'-PP7-tagged pegRNA for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_pegRNA_(PP7-C4-Q1)
Plasmid#232435PurposepegRNA with optimized 3' modifications to correct the rd12 mutationDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd12_nsgRNA(PP7)
Plasmid#232436PurposensgRNA for PE3b correction of the rd12 mutation, contains a PP7 in the scaffold tetraloopDepositorInsertPP7-tagged nicking gRNA (PE3b) for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCFD3-dU6:3gRNA
Plasmid#49410Purposeexpression of gRNA under control of the Drosophila U6:3 promoterDepositorInsertdU6-3:gRNA
UseCRISPRExpressionInsectPromoterdU6-3Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v2
Plasmid#97082PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v2
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJAT31
Plasmid#204291PurposeFor inserting a phiC31 attP site. HDR integrant is marked with ie1-DsRed, which is expressed in abdomen and mouthparts. Second U6 promoter allows use of two different gRNAs in two synthesized arms.DepositorInsertie1-DsRed
UseCRISPRPromoterie1Available SinceSept. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD18T-AtU6-HV5
Plasmid#239470PurposeEncodes a gRNA expression cassette driven by the AtU6 promoter.DepositorInsertU6-gRNA
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pICH86966::AtU6p::sgRNA_PDS
Plasmid#46966PurposeExpresses an sgRNA targeting the PDS gene in Nicotiana benthamiana from the Arabidopsis U6 promoterDepositorInsertAtU6p::sgRNA_PDS
UseCRISPR; Plant expressionAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-GFP-SFPQ
Plasmid#97084PurposeEncodes an sgRNA that creates a DSB at the promoter of human SFPQ gene.DepositorInsertsgRNA GFP-SFPQ
UseCRISPRPromoterU6Available SinceJuly 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCFD1-dU6:1gRNA
Plasmid#49408Purposeexpression of gRNA under control of the Drosophila U6:1 promoterDepositorInsertdU6-1:gRNA
UseCRISPRExpressionInsectPromoterdU6-1Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
PU6::unc-119_sgRNA
Plasmid#46169Purposeunc-119 targeting sgRNADepositorInsertunc-119 targeting sgRNA (unc-119 Synthetic)
UseCRISPRPromoterC. elegans U6 snRNA pol III promoterAvailable SinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCFD2-dU6:2gRNA
Plasmid#49409Purposeexpression of gRNA under control of the Drosophila U6:2 promoterDepositorInsertdU6-2:gRNA
UseCRISPRExpressionInsectPromoterdU6-2Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-ST1-sgRNA
Plasmid#48672PurposeMammalian U6-driven sgRNA (STm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. thermophilus #1 Cas9, hU6 promoter
UseCRISPRPromoterhUAvailable SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX330-NEAT1pr_v1
Plasmid#97081PurposeEncodes an sgRNA that creates a DSB at the promoter of human NEAT1 geneDepositorInsertsgRNA NEAT1pr_v1
UseCRISPRPromoterU6Available SinceJuly 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
OA-1050G (white)
Plasmid#132420Purposeexpress arrays of gRNA targeting White under dU6-3 promoterDepositorInsertwhite gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050J (GFP)
Plasmid#133304Purposeexpress arrays of gRNA targeting GFP under dU6-3 promoterDepositorInsertGFP gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF824_U6-Sau-sgRNA-EF1a-mCherry2_lenti
Plasmid#138318PurposeLenti expression of mCherry2 with U6 promoter for SauCas9 sgRNA targeting GFPDepositorInsertSauCas9 GFP sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCF820_U6-sgRNA-EF1a-mCherry2_lenti
Plasmid#138316PurposeLenti expression of mCherry2 with U6 promoter for SpyCas9 sgRNA targeting GFPDepositorInsertSpyCas9 GFP sgRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHS-MRscRNA
Plasmid#240214PurposeMammalian vector for transient expression of theophylline-responsive MR-scRNA with mCherry transfection markerDepositorInsertTheophylline MR-scRNA targeting TET3G promoter
ExpressionMammalianPromoterU6Available SinceNov. 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
OA-1050I (notch)
Plasmid#132421Purposeexpress arrays of gRNA targeting Notch under dU6-3 promoterDepositorInsertnotch gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050K (firefly luciferase)
Plasmid#132422Purposeexpress arrays of gRNA targeting Firefly Luciferase under dU6-3 promoterDepositorInsertfirefly Luciferase gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050U (cinnabar)
Plasmid#132423Purposeexpress arrays of gRNA targeting Cinnabar under dU6-3 promoterDepositorInsertcinnabar gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050V (wingless)
Plasmid#132424Purposeexpress arrays of gRNA targeting Wingless under dU6-3 promoterDepositorInsertwingless gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
OA-1050Z4 (yellow)
Plasmid#132425Purposeexpress arrays of gRNA targeting Yellow under dU6-3 promoterDepositorInsertyellow gRNA array
ExpressionInsectPromoterU6-3Available SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron3_sg2_pX330
Plasmid#127174PurposesgRNA that cuts within intron 3 of mouse Cdk12 genomic locus in pX330 backboneDepositorInsertMouse Cdk12 Intron 3 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailabilityAcademic Institutions and Nonprofits only -
Cdk12_intron4_sg1_pX458
Plasmid#127175PurposesgRNA that cuts within intron 4 of mouse CDK12 genomic locus in pX458 backboneDepositorInsertMouse Cdk12 Intron 4 sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-mU6gRNA5(SapI)-hU6gRNA5(BbsI)-PGKpuroBFP-W
Plasmid#72667PurposeLentiviral dual CRISPR gRNA expression vector (mouse U6 and human U6 promoters)DepositorInsertmU6gRNA cassette, hU6gRNA cassette, PGKpuroBFP cassette, WPRE
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6_B2M_sgRNA(PP7)
Plasmid#232438PurposesgRNA to facilitate a splice donor site disruption via adenine base editing in the B2M locus, contains a PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged gRNA for B2M disruption via splice donor consensus disruption via ABE8e or Cas9 driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6_HEK3+1T>A_(PP7-C4-Q1)
Plasmid#232437PurposepegRNA with optimized 3' modifications to facilitate a +1 T to A prime edit in the HEK3 locusDepositorInsert3'-PP7-tagged pegRNA for rd12 correction driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only