-
Plasmid#206268PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes SpCas9 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertSpCas9
UseCRISPR; Recombinant baculovirus productionTagsExpressionMammalianMutationPromoterAvailable sinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330-NLC-DHFR-SpCas9
Plasmid#124523PurposeExpresses SpCas9 fused to DHFR domains on both the N- and C- termini and an internal loop in mammalian cellsDepositorInsertNLC-DHFR-SpCas9
UseAAVTagsDestabilized domain of E.coli dihydrofolate reduc…ExpressionMammalianMutationPromoterCbhAvailable sinceJuly 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1114a
Plasmid#87397PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1114a sequence CTTGTGAAACAAATAATTGG in yeast chromosome 11.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1114a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLY152
Plasmid#130950Purposedcas9 generator and reporter circuit (PpspA-2G6 with sfgfp::ASV)DepositorInsertsdcas9
tetR
sfgfp
UseSynthetic BiologyTagsASV tagExpressionBacterialMutationMutations D10A and H840A on WT cas9. Synonymous m…PromoterPpspA-2G6 and PtetAvailable sinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable sinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-ARS308a
Plasmid#87384PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS308a sequence CACTTGTCAAACAGAATATA in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS308a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(A)
Plasmid#85570PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
H517 SONIC HRASV12 donor
Plasmid#138177PurposeCRISPR SONIC: HRAS G12V donor plasmidDepositorInsertHRASV12 (HRAS Human)
UseNhej donorTagsExpressionMutationPromoterAvailable sinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.VSVg_mCherry-NLS
Plasmid#178220PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.S_mCherry-NLS
Plasmid#178219PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.HSV_mCherry-NLS
Plasmid#178216PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.HSV and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.VSVg_mCherry-NLS
Plasmid#178214PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.S_mCherry-NLS
Plasmid#178213PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.HSV_mCherry-NLS
Plasmid#178210PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.HSV and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
JG1202: CAG-human dLbCpf1(D832A)-NLS-3xHA-P65
Plasmid#104566PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to p65 activation domainDepositorInsertdLbCpf1(D832A)-p65
UseTags3x HA and NLSExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS511b
Plasmid#87387PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS511b sequence CAGTGTATGCCAGTCAGCCA in yeast chromosome 5.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS511b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV_Actb HR donor_U6_sgRNA_EF1a_GFP_polyA
Plasmid#97309PurposeHR donor for fusing a p2A-mCherry reporter to mouse Actb. EGFP driven by EF1a promoter and U6-driven sgRNAs targeting Actb. AAV backbone.DepositorInsertActb HR donor
UseAAV and Mouse TargetingTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO_NWS.Ollas.S_mCherry-NLS
Plasmid#178279PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNWS.Ollas.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.S.V5_mCherry-NLS
Plasmid#178278PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.S.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.Ollas.V5_mCherry-NLS
Plasmid#178277PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.Ollas.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HSV.NWS.S_mCherry-NLS
Plasmid#178273PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHSV.NWS.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1309a
Plasmid#87399PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1309a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pdpy-30-miniCAFE
Plasmid#170115PurposeDpy-30 promoter-driven expression of a truncated VPR-dCjCas9 fusion protein (MiniCAFE) for activation of gene expression.DepositorInsertMiniCAFE
UseCRISPRTagsExpressionMutationD8A, HNH-truncation (Δ495–609 aa) in CjCas9PromoterDpy-30Available sinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_1
Plasmid#124912PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
ACTB-PQR-RFPnols-PQR-loxP-Zeo-loxP
Plasmid#121448PurposeTo make a stable human recombinant cell line; see right thumbnail map image for PQR annotationsDepositorInsertRFPnols-PQR-ZeocinR (ACTB Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc enAspCas12a
Plasmid#182127PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc enAspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc enAspCas12a
UseTags6xHisExpressionBacterialMutationPromoterT7Available sinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB-PE VQR
Plasmid#162797PurposeAll-in-one prime editor piggyBac transposon, VQR variantDepositorInsertSpCas9_H840A_VQR-PE2-MMLV-RT(dBB)-P2A-PAC_dTK(dBB)
UseCRISPR and Synthetic Biology; Piggybac transposonTagsSV40 NLSExpressionMammalianMutationD1135V, R1335Q, T1337RPromoterCAGAvailable sinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDB-hCRY1-SNAP-CD4-bla
Plasmid#179447PurposeDonor vector to knock in SNAPtag C-terminal to human CRY1 geneDepositorInsertSnapTag
UseCRISPRTagsHis/FlagExpressionMutationPromoterNoneAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.S.VSVg_mCherry-NLS
Plasmid#178269PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.VSVg_mCherry-NLS
Plasmid#178261PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.HSV.S_mCherry-NLS
Plasmid#178260PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsHA.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.S.VSVg_mCherry-NLS
Plasmid#178255PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.S.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.VSVg_mCherry-NLS
Plasmid#178246PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HSV.S_mCherry-NLS
Plasmid#178245PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HSV.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.VSVg_mCherry-NLS
Plasmid#178241PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.S_mCherry-NLS
Plasmid#178240PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.S and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_C.HA.HSV_mCherry-NLS
Plasmid#178237PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsC.HA.HSV and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.VSVg_mCherry-NLS
Plasmid#178225PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.VSVg and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_2
Plasmid#124911PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgMAPKAP1_3
Plasmid#124913PurposeTargeting human MAPKAP1 (SIN1) gene by CRISPR-Cas9DepositorInsertMAPKAP1 (MAPKAP1 Human)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ACTB CRISPIE
Plasmid#172853PurposeActb sgRNA & DRS-2 sgRNA expression under U6. CRISPIE donor mEGFP phase (0-0), excised by DRS-1 or DRS-2 (with SpCas9). Also expresses mRuby3 under the CBA promotor. See Zhong et al, eLife 2021.DepositorInsertsActb intron 1 sgRNA
DRS-2 sgRNA
CRISPIE designer exon (phase 0-0) encoding mEGFP
mRuby3
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.Ollas_mCherry-NLS
Plasmid#178223PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.V5_mCherry-NLS
Plasmid#178221PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HA.Ollas_mCherry-NLS
Plasmid#178218PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HA.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.V5_mCherry-NLS
Plasmid#178215PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.V5 and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.Ollas_mCherry-NLS
Plasmid#178212PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.Ollas and Nuclear Localization SignalExpressionMutationPromotereF1aAvailable sinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only