We narrowed to 17,637 results for: URE
-
Plasmid#47356PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L113EPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN F122D
Plasmid#47357PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, F122DPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN W284A
Plasmid#47358PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, W284APromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN V315R
Plasmid#47359PurposeClock fragment mutatation tagged with VenN used for BiFCDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, V315RPromoterCMVAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Bmal Pas 1-465-VenC L115E
Plasmid#47377PurposeBmal fragment cloned with Venus tag used for mutationDepositorAvailable SinceJan. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
HLH Clock Pas 1-401 VenN L57E
Plasmid#47354PurposeClock fragment mutatation tagged with VenNDepositorInsertClock (Clock Mouse)
TagsVenus aa 1-155ExpressionMammalianMutationaa 1-401, L57EPromoterCMVAvailable SinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1 hSlp4-a I18A
Plasmid#40066DepositorInserthSlp4-a I18A (SYTL4 Human)
TagsGSTExpressionBacterialMutationIsoleucine 18 to AlaninePromoterTacAvailable SinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-1 hSlp4-a W118S
Plasmid#40065DepositorInserthSlp4-a W118S (SYTL4 Human)
TagsGSTExpressionBacterialMutationTryptophane 118 to SerinePromoterTacAvailable SinceOct. 16, 2012AvailabilityAcademic Institutions and Nonprofits only -
23SrRNA.RAV12(wt).2508-2580.GAAAC.duplexH90
Plasmid#26192DepositorInsert23S ribosomal RNA fragment (modified) with duplex H90
ExpressionBacterialMutationfragment 2508-2580 of E. coli rRNA, with nucleotiā¦Available SinceDec. 8, 2010AvailabilityAcademic Institutions and Nonprofits only -
pIS58 TIP120A 3'UTR mut
Plasmid#14502DepositorInsertTIP120A 3'UTR mutant (CAND1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationCATTCCās were changed to AAGTAC'sAvailable SinceMarch 7, 2007AvailabilityAcademic Institutions and Nonprofits only -
integrin beta6 777T pBS
Plasmid#13581DepositorInsertintegrin beta 6 777T (ITGB6 Human)
ExpressionBacterialMutation777T. Lacks last 11 amino acids of cytoplasmic doā¦Available SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAN1646
Plasmid#127205PurposepTet expression of Venus, Dual inducible expression of dCas9-VP64-mScarlet-degronSwitchA and KeyA-BFP-NLSDepositorInsertp7x_tet-Venus-tADH1-pGal1-dCas9-VP64-Linker-mScarlet-Linker-degronSwitch_A_t12-tPGK1-pZ3-key_A_e18-mTagBFP2-NLS(SV40)-tSSA1
UseSynthetic BiologyAvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1
Plasmid#218796PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA 3.2/V5-DEST RBM14-V5
Plasmid#69823PurposeExpresses RBM14-V5 in mammalian cellsDepositorInsertRNA-binding protein 14 (RBM14 Human)
UseRetroviralTagsv5ExpressionMammalianPromotercmvAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-CMV-dnMCAK
Plasmid#205993PurposeOver-expression of GFP-dnMCAKDepositorInsertdnMCAK
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
PZac2.1 gfaABC1D-Cx43-GFP
Plasmid#176860PurposeExpresses Cx43 fused with GFP at the C-terminus in astrocytesDepositorAvailable SinceApril 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
p21-WT-MEFV
Plasmid#134702PurposeLentiviral expression of human MEFV after doxycycline administrationDepositorAvailable SinceDec. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
GfaABC1D-DIO-Lck-mCherry-ibARK(D110A)-4x6T
Plasmid#241244PurposeNegative control vrial expression vector for Cre-dependent expression plasma membrane-tethered ibARK with higher specificity in astrocytesDepositorInsertDIO-Lck-mCherry-ibARK(D110A)-4x6T
UseAAVMutationD110AAvailable SinceOct. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMGF182
Plasmid#97006PurposeExpresses GFP-CHMP7 in mammalian cells under a crippled promoterDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-PR rep/cap
Plasmid#197565Purposeencodes AAV-PR capsid that transduces pericytes and smooth muscle cells in mice after systemic deliveryDepositorInsertsAAV Rep genes
AAV9 VP1 Cap gene with PR insert
UseAAVMutationcontains 7mer insert PRPPSTH between amino acids ā¦Available SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOT_2 - lenti-EFS-tNGFR-2A-puro
Plasmid#181971PurposeExpresses human truncated NGFR linked to puromycin resistance via P2A for lentiviral delivery.DepositorAvailable SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-mCherry-IRES-Flpo
Plasmid#55634PurposeExpresses Flpo in Mammalian CellsDepositorHas ServiceAAV Retrograde and AAV1InsertsmCherry
Flpo
UseAAVExpressionMammalianPromoterEf1a and Ef1a/IRESAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLQ14256
Plasmid#239275PurposeExpresses Kif5a*-PYL1 for the anterograde transport of RNA along microtubules via CRISPR-TO in primary mouse cortical neuronsDepositorAvailable SinceSept. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMGF196
Plasmid#97005PurposeExpresses LEMD2-mCherry in mammalian cells under a crippled promoterDepositorAvailable SinceAug. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7
Plasmid#214812PurposeMammalian expression of SpCas9 PE7 prime editorDepositorInsertPE7
TagsSV40 bpNLS and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI30
Plasmid#183749PurposeAAV-BI30 Rep-Cap plasmid for production of AAV-BI30, a capsid with tropism for CNS endothelial cells.DepositorInsertAAV9 modified with 7mer insertion between amino acids 588 and 589 of VP1
UseAAVMutationK449R, and NNSTRGG inserted between 588 and 589 oā¦Promoterp41Available SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-PE7 for IVT
Plasmid#214813PurposeTemplate for in vitro transcription of PE7DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSPromoterT7 (inactivated)Available SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2
Plasmid#132775PurposePrime editing in mammalian cells. This plasmid is used by PE2, PE3, and PE3bDepositorInsertPE2
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG RpH-LAMP1-3xFLAG
Plasmid#163018Purposeexpresses ratiometric sensor of lysosomal lumenal pHDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvFLAG
Plasmid#234990PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti FLAG scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA-3C-myc-scfvFLAG
ExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pStreptagII 3C SMO
Plasmid#234995PurposeExpression of a Strep-tag II labeled on its N-terminus receptor, with the Smoothened (Smo) receptorDepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEABR NA 3C FLAG SA
Plasmid#234987PurposeFor production of Extracellular Vesicles (EVs), with the transmembrane region of Neuraminidase protein fused to Streptavidin on the vesicles surfaceDepositorInsertEABR-NA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4ā¦Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT/TO-mNeonGreen-BRD4
Plasmid#204692PurposeThis plasmid allows for inducible expression of short BRD4 isoform tagged with mNeonGreen, in mammalian cells.DepositorAvailable SinceAug. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
T7_CC_PE7_IVT_Template
Plasmid#223022PurposeTemplate for in vitro transcription of PE7. For HSPC-related experiments.DepositorInsertPE7
UseTemplate for in vitro transcriptionTagsSV40 bpNLS and c-Myc NLSPromoterT7Available SinceAug. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE2-P2A-GFP
Plasmid#132776PurposePrime editing in mammalian cells with co-translational GFP expressionDepositorInsertPE2-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationSee manuscriptPromoterCMVAvailable SinceJan. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCold-I-Dsup
Plasmid#90021PurposeTo express His-tagged Dsup in bacteriaDepositorInsertDsup
TagsHisExpressionBacterialPromotercspAAvailable SinceMay 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmCherry N1 MFN2
Plasmid#157759PurposeExpression of MFN2:mcherry in cellsDepositorAvailable SinceFeb. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-BI-hTFR1-2
Plasmid#218797PurposeRepCap for AAV productionDepositorInsertAAV Rep-Cap BI-hTFR1-2
ExpressionMammalianAvailable SinceMay 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-Chronos-GFP
Plasmid#58805PurposeAAV expression of Chronos-GFP under the CaMKII promoterDepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterCaMKIIAvailable SinceAug. 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMSCV_IRES_GFP_CD16a
Plasmid#196189PurposeRetroviral expression plasmid for generating stable FCGR3A (CD16a)-expressing cell lines.DepositorInsertCD16a (FCGR3A Human)
UseRetroviralExpressionMammalianMutationchanged Phenylalanine 158 to ValinePromoterLTRAvailable SinceSept. 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Cilantro 2
Plasmid#74450PurposeCan clone in a C2H2 zinc finger via BsmBI restriction sites and monitor post-translational degradation using EGFP:mCherry ratio (Lentiviral, PGK.BsmBICloneSite-EGFP.IRES.mCherry.cppt.EF1a.PuroR)DepositorTypeEmpty backboneUseLentiviralTagsEGFPAvailable SinceJuly 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-FLAG-SF3B1-WT
Plasmid#82576PurposeExpresses a codon-optimized ORF of human SF3B1 (wild-type)DepositorAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJR85
Plasmid#140095PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region. BsmBI sites were removed to allow for programmed dual sgRNA library cloning.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-Gal3
Plasmid#85662PurposeFluorescent reporter for lysosomal damageDepositorAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-Cre
Plasmid#121675PurposeExpresses Cre recombinase and HA tag in a Flp dependent fashion (fDIO)DepositorHas ServiceAAV Retrograde, AAV1, AAV5, AAV8, and AAV9InsertNLS-CRE-HA
UseAAVTags3xHA and SV40-NLSExpressionMammalianPromoterEF1aAvailable SinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-Cre-3xmiR122-WPRE-HGHpA
Plasmid#183776PurposeAAV genome with a CAG driven Cre recombinase with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertCre
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
IF-GFP-ATRX
Plasmid#45444PurposeATRX expression vectorDepositorInsertATRX (ATRX Mouse, Human)
TagsGFP and HAExpressionBacterial and MammalianMutationisoform 2, missing codon E124PromoterPCMVAvailable SinceMay 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
PC1575
Plasmid#232088PurposeMammalian expression plasmid for ubiquibody (uAb) cloning backbone. Includes an Esp3I restriction site directly upstream of GSGSG linker and CHIPĪTPR CDS and a C-terminal IRES-mCherry cassette.DepositorInsertuAb with cloning Esp3I restriction site
TagsIRES-mCherryExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only