173,219 results
-
Plasmid#193685PurposeConstitutive lentiviral expression of SLC2A1DepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nanoluc-ccdB
Plasmid#87070PurposeMammalian Gateway-compatible expression vector backbone with an N-terminal Nanoluc luciferaseDepositorTypeEmpty backboneTagsNanoluc luciferaseExpressionMammalianAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
AiP12674 - pAAV-AiE0086h-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2674)
Plasmid#230124PurposeAiE0086h is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertSYFP2
UseAAVPromoterminBGAvailable SinceNov. 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
N-terminal Halo-Ku70
Plasmid#207547PurposeHomologous recombination donor to insert halo tag at the N terminal of the endogenous Ku70 locus.DepositorInsertHaloTag with flanked by human Ku70 locus sequences
TagsHaloTagExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
[#GS24 -LV] Syn1-GFP-OMP25
Plasmid#233566PurposeLentiviral construct of mitochondrial localized GFP to be expressed in the donor cells under the Synapsin1 promotorDepositorInserteGFP (eGFP Aequorea victoria, Synthetic)
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pC0047-CMV-dPspCas13b-ADAR1DD(E1008Q)
Plasmid#103863PurposedPspCas13b-ADAR1DD(E1008Q) fusion that can be used to selectively edit adenosine to inosine in RNA molecules when used in conjuction with a guide RNADepositorInsertsUseCRISPRExpressionMammalianMutationChanged histidne 133 to alanine and histidine 105…Available SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
pNluc-hbb
Plasmid#239753PurposeTemplate for in vitro transcription of nanoluciferase flanked by the human haemoglobin beta 5' and 3' UTRs.DepositorInsertNanoluciferase flanked by human haemoglobin beta 5' and 3' UTRs
UseLuciferasePromoterT7 (included as part of insert)Available SinceJuly 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLHCX-XBP1 mNeonGreen NLS
Plasmid#115971PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreen (retroviral vector backbone)DepositorInsertX-box binding protein 1 (XBP1 Human, Synthetic)
UseRetroviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
iBE4max YE1 NG CLYBL
Plasmid#174570Purposedoxycycline inducible BE4max YE1 NG expression for human CLYBL locus knock-inDepositorInsertBE3
ExpressionMammalianPromotertet ONAvailable SinceJan. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
CHRM3-Tango
Plasmid#66250PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorAvailable SinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET22b-His6-UBCH7
Plasmid#212711PurposeBacterial expression of His6-UBCH7DepositorInsertUBCH7
Tags6xHisExpressionBacterialAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
dCas12Max-ABE
Plasmid#195335Purposevector for encoding a human codon-optimized dCas12Max-ABE driven by CBh promoter, guide RNAs compatible with xCas12i driven by hU6, and mCherry driven by CMV promoterDepositorInserthuman codon-optimized dCas12Max-ABE
ExpressionMammalianMutationN243R, E336R, D1049APromoterCBh, CMV, hU6Available SinceMarch 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTK229
Plasmid#71256Purposeluciferase reposter with 229 bp of the HSV TK promoterDepositorInsertThymidine Kinase promoter
UseLuciferaseTagsluciferaseExpressionMammalianPromoterHSV Thymidine KinaseAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-IE1
Plasmid#52894Purposebaculovirus IE-1 promoter driving firefly luciferaseDepositorInsertIE1 promoter
UseLuciferasePromoterbaculovirus IE1Available SinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
mEmerald-WASP1-C-14
Plasmid#54314PurposeLocalization: Cytoskeleton, Excitation: 487, Emission: 509DepositorAvailable SinceJune 16, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMV500 empty vector
Plasmid#33348DepositorTypeEmpty backboneTagsFlagExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2011AvailabilityAcademic Institutions and Nonprofits only -
pIVT_hifiDn29-dCas9-P2A-GFP
Plasmid#247168PurposeIn vitro transcription of human codon optimized fusion of hifiDn29-dCas9-P2A-GFPDepositorInserthifiDn29-dCas9-P2A-GFP
UseIn vitro transcriptionTagsSV40 NLSMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503N/I98V…Promotermutated T7Available SinceNov. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
TetO-FUW-Klf4
Plasmid#20322DepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
-
FUW-TetON-GFP
Plasmid#115495PurposeLentiviral plasmid for tet-inducible expression of GFP (generated from plasmid #20321)DepositorInserteGFP
UseLentiviralAvailable SinceNov. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pICH47742
Plasmid#48001DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV-HNF4A-FOXA2-FOXA3
Plasmid#149724Purposeexpressing three liver promoting transcription factors (HNF4A, FOXA2, FOXA3)DepositorInsertHNF4A-FOXA2-FOXA3
UseLentiviralTagsP2A, T2APromoterCMVAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Halo-DNAPKcs
Plasmid#210787PurposePlasmid for expression of HaloTag-DNA-PKcs in mammalian cellsDepositorInsertDNA-PKcs
Tags3xFLAG-HaloTagExpressionMammalianPromoterCMVAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
FU-tet-o-hKLF4
Plasmid#19777DepositorAvailable SinceFeb. 23, 2009AvailabilityAcademic Institutions and Nonprofits only -
pICH50900
Plasmid#48047DepositorTypeEmpty backboneUseUnspecifiedAvailable SinceDec. 3, 2013AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFX-mito-EYFP
Plasmid#174182PurposeExpress EYFP with mitochondria-targeting sequence in mammalian cellsDepositorInsertEYFP with mitchondria-targeting sequence
Tagsthe mitochondria-targeting sequence of the cytoch…ExpressionMammalianPromoterCMVAvailable SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFRT-FLAG-HA-(N)-CDK12
Plasmid#231750PurposeExpression in Flp-IN human cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-cytoEKAR4
Plasmid#174438PurposeCytosol-targeted EKAR4.DepositorInsertcytoEKAR4
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceSept. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28a-tdTomato-CNA35
Plasmid#61606Purposebacterial expression of N-terminal fusion protein of CNA35 with tdTomatoDepositorInserttdTomato and CNA35
TagsHis tagExpressionBacterialPromoterT7Available SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
ATG9A-EGFP
Plasmid#210367PurposeExpresses ATG9A fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pACDura3
Plasmid#138711PurposeExpresses group II intron Ll.LtrB and IEP (LtrA) from Lactoccus lactis under control of T7 promoter. Ll.LtrB is retargeted to insert into 635s locus of LacZ gene and ura3 gene is cloned inside.DepositorInsertura3 gene (URA3 Budding Yeast)
ExpressionBacterialMutationoptimized ura3 gene for expression in Escherichia…PromoterpEM7 promoterAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSSa26
Plasmid#186784PurposeExpression of reverse transactivator (CgrtTA)DepositorInsertCgrtTA
ExpressionYeastPromoterScPGK1pAvailable SinceJuly 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
T4 td upstream intron-PABP
Plasmid#189972PurposePart 1 plasmid to introduce the T4 td upstream intron and PABP spacer into circRNAsDepositorInsertT4 td upstream intron-PABP
UseCloningPromoterN/AAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCruzHA SIRT1
Plasmid#10962DepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSEM246 - mosTI - unc-119 - MCS
Plasmid#182343PurposeEmpty cloning vector for mosTI(unc-119). MCS or Golden Gate (BsaI: tgcc - MCS - gagc)DepositorTypeEmpty backboneExpressionWormAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SV40NLSf-GFP-3xmiR122-WPRE-HGHpA
Plasmid#183775PurposeAAV genome with a CAG driven eGFP reporter with mR122 target sequence repeats to reduce transgene expression in hepatocytes.DepositorInsertNLS-GFP
UseAAVMutationNAPromoterCAGAvailable SinceMay 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTP1005
Plasmid#104160PurposeBacterial expression plasmid of anti-mouse IgG2a Fc nanobody TP1129 (3x Cysteines)DepositorInsertAnti-mouse IgG2a Fc specific nanobody TP1129 (3xCysteines)
Tags14xHistidine tag and NEDD8 from Brachypodium dist…ExpressionBacterialAvailable SinceDec. 21, 2017AvailabilityAcademic Institutions and Nonprofits only -