We narrowed to 5,985 results for: crispr cas9 expression plasmids
-
Plasmid#165484PurposeStable expression of a zebrafish optimized Cas9 driven by a tilapia promoter in fish cellsDepositorInsertZebrafish optimized Cas9 (nls-zcas9-nls from Wenbiao Chen Lab plasmid pCS2-nCas9n Addgene #47929)
UseCRISPR; TransposonTagsExpressionMutationPromoterOreochromis mossambicus EF1 alpha promoter (OmEF1…Available sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sg1HsAGO2_AH
Plasmid#148848PurposeMammalian Expression of HsAGO2-sgRNA1DepositorInsertHsAGO2-sgRNA1 (AGO2 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sg2HsAGO2_AH
Plasmid#148851PurposeMammalian Expression of HsAGO2-sgRNA2DepositorInsertHsAGO2-sgRNA2 (AGO2 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsAGO1_AH
Plasmid#148854PurposeMammalian Expression of HsAGO1-sgRNADepositorInsertHsAGO1-sgRNA (AGO1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro-V2.0-sgHsNot1_AH
Plasmid#148856PurposeMammalian Expression of HsNot1-sgRNADepositorInsertHsNot1-sgRNA (CNOT1 S.pyogenes)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-SpyCas9
Plasmid#113034PurposeAAV vector for expression of SpyCas9 in mammalian cellsDepositorInsertSpyCas9
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-EGFP
Plasmid#118156PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-EGFP under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-EGFP
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationPromoterEF1a core and U6Available sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pXCas9H840A
Plasmid#60900PurposeDual Expression Vector for Cas9 H840A nickase and gRNADepositorTypeEmpty backboneUseCRISPRTags3XFLAGExpressionMammalianMutationPromoterCBh and U6Available sinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
EC2_4_dCas9_VPR_sgRNA
Plasmid#163709PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_3_dCas9_Mxi1_sgRNA
Plasmid#163708PurposeYeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressorDepositorInsertsdCas9
Mxi1+SV40 NLS
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
UseTagsExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9C
Plasmid#80931PurposeExpresses Cas9C in mammalian cells.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW-Cas9-2A-EGFP
Plasmid#167928PurposeDoxycycline-inducible Cas9 expression tracked by EGFP fluorescence marker.DepositorInsertT2A-EGFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotertTRE, hPGKAvailable sinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-3xFLAG-hSpCas9
Plasmid#162161PurposeExpresses 3xFLAG tagged hSpCas9 (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter)DepositorInsertshSpCas9
sgRNA
UseCRISPRTags3xFLAGExpressionInsectMutationPromoterAe. aegypti PUb and Ae. aegypti U6Available sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry
Plasmid#64324PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianMutationPromoterCBh and U6Available sinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-BFP
Plasmid#64323PurposeExpression vector for sgRNAs cloned into the BbsI sites and for expression of Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA cassette
UseCRISPRTags3xFLAG, NLS, and T2A-EBFP2ExpressionMammalianMutationPromoterCBh and U6Available sinceMay 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-BsaIx2-DD-Cas9
Plasmid#75380PurposeExpresses DD-SpCas9 in mammalian cells and has a cloning site for an sgRNA. The FKBP12 L106P destabilization domain allows for inducible stabilization of Cas9 through the addition of Shield-1DepositorInsertDD-SpCas9
UseCRISPRTagsFKBP12 L106P DDExpressionMammalianMutationPromoterCAGAvailable sinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNHEJ-Cas9-recX
Plasmid#158715PurposeCRISPR-assisted-NHEJ system used for genome editing in Mycobacterium smegmatis. Helper plasmid expresses Cas9, NHEJ machinery of M. marinum and recXDepositorInsertcas9
UseCRISPRTagsExpressionBacterialMutationPromoterTetOAvailable sinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSExpressionMutationPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
BB3cH_pGAP_23*_pPFK300_Cas9
Plasmid#104912PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on HygDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pPFK300_Cas9
Plasmid#104910PurposehCas9 under control of pPFK300 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cK_pGAP_23*_pLAT1_Cas9
Plasmid#104908PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on G418DepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
BB3cN_pGAP_23*_pLAT1_Cas9
Plasmid#104906PurposehCas9 under control of LAT1 for direct cloning of HH-sgRNA-HDV PCR products for episomal expression in P. pastoris and selection on NTCDepositorInsertsHH - FS23 linker - HDV
human codon-optimized hcas9 sequence fused to a nuclear localization signal (NLS)
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceFeb. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
SP6-hCas9-Ce-mRNA
Plasmid#47911PurposeIn vitro transcription of a mRNA encoding humanized Cas9 nuclease, with 3' UTRs suitable for germline expression in C. elegans, for doing CRISPR-Cas by RNA injection. Uses SP6 RNA polymerase.DepositorInserthCas9 with C. elegans 5' and 3' UTRs
UseCRISPRTagsExpressionMutationPromoterSP6Available sinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
1137B=Hsp70Bb-Cas9
Plasmid#153284PurposeThe attB plasmid harboring the Hsp70Bb-Cas9-T2A-eGFP-p10 and a mini-white marker.DepositorInsertpHsp70Bb-SpCas9-T2A-eGFP-p10 (cas9 Synthetic)
UseCRISPRTagseGFPExpressionInsectMutationPromoterDmel Hsp70BbAvailable sinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKS diaCas9_sgRNA
Plasmid#74923PurposeExpresses Cas9 codon optimized for Phaeodactylum tricornutum and a sgRNA driven by a U6 promoterDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPRTagsExpressionMutationPromoterCas9 module and sgRNA moduleAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-Tet1-CD
Plasmid#83340PurposeTo introduce dCas9-fused Tet1-CD and sgRNA2.0 systemDepositorInsertdCas9-Tet1-CD and sgRNA scaffold with 2xMS2 binding sites
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterU6, CBHAvailable sinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCXLE-dCas9GFP-shP53
Plasmid#102906PurposeEBNA episome plasmid for CAG promoter constitutive expression of dCas9-GFP. Includes p53 shRNA expression cassette.DepositorInsertdCas9GFP-shP53
UseCRISPRTagsExpressionMammalianMutationD10A, H840APromoterCAGAvailable sinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
Native promoter dCas9
Plasmid#113656PurposedCas9 expression unit plasmid. The dCas9 expression unit plasmids contain connector ConL1, ConRE, and one dCas9 transcriptional unit.DepositorInsertNative promoter and dCas9
UseCRISPRTagsExpressionBacterialMutationPromoterS. pyogenes Cas9 native promoterAvailable sinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-EF1a-KRAB-dCas9-P2A-BlastR
Plasmid#118154PurposeCatalytically inactive Cas9 from S. pyogenes with P2A-BlastR under the EF1a core promoter, and cloning backbone for sgRNA. Contains BsmBI sites for insertion of spacer sequences.DepositorInsertKRAB-dCas9-P2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianMutationSee depositor comments belowPromoterEF1a core and U6Available sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP314-pAAV-U6SaCas9gRNA(SapI)-CMV-SaCas9-DIO-pA
Plasmid#113691PurposeU6 driven SaCas9 gRNA expression cassette followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorInsertSaCas9
UseAAV, CRISPR, and Cre/LoxTagsNLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP315-pAAV-U6SaCas9gRNA(CREB)-CMV-SaCas9-DIO-pA
Plasmid#113692PurposeU6 SaCas9 gRNA expression cassette containing a gRNA targeting the CREB gene, followed by a CMV driven inverted SaCas9. SaCas9 is floxed to render the system cre-dependent.DepositorUseAAV, CRISPR, Cre/Lox, and Mouse TargetingTagsNLSExpressionMutationPromoterCytomegalo Virus(CMV)Available sinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-TO-dCas9-P2A-HSA
Plasmid#121936PurposeCRISPR-Sirius plasmidDepositorInsertdCas9-P2A-HSA
UseCRISPR and LentiviralTagsHSAExpressionMammalianMutationPromoterCMV-TOAvailable sinceFeb. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K855A
Plasmid#108298PurposepX459 V2.0 (Plasmid #62988) with the K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A
Plasmid#108297PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-RSV-SpCas9
Plasmid#85450PurposeExpress SpCas9 in mammalian cellsDepositorInsertpRSV
UseAAVTagsExpressionMutationPromoterpRSVAvailable sinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only