-
Plasmid#113626PurposesgRNA/CAS9 expression plasmid to induce a 3’ double-strand break in the 4-μHOM reporter 8 nts. upstream from the microhomologyDepositorInsert7i sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pScI_dCas9-CDA_J23119-sgRNA
Plasmid#108550PurposeBacterial Target-AID vector with sgRNADepositorInsertsdCas9-PmCDA1
Streptococcus pyogenes sgRNA
UseTagsFlagExpressionBacterialMutationD10A and H840A for SpCas9PromoterJ23119 and lambda ORAvailable sinceSept. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 2
Plasmid#51761PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 2
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
px459-Hira KO sgRNA
Plasmid#186938PurposeHira KO in mouse ES cellsDepositorInsertHira KO sgRNA (Hira Mouse)
UseCRISPR and Mouse TargetingTagsExpressionMammalianMutationPromoterU6Available sinceAug. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #1
Plasmid#202516PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorInsertRB1 sgRNA (RB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP-43 sgRNA1
Plasmid#133762PurposeExpresses Cas9 and human TDP-43 sgRNADepositorInsertTDP-43 (TARDBP Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceDec. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G3_Dual_sgRNA
Plasmid#86613PurposeVector for tandem expression of ATP1A1 G3 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G3 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via hdr using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - CTRL sgRNA
Plasmid#70662PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and a non-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertnon-targeting sgRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLH-sgRNA1-2XboxB
Plasmid#75391PurposesgRNA1-2XboxBDepositorInsertsgRNA1-2XboxB
UseCRISPR and LentiviralTagsnoExpressionMammalianMutationPromoterU6Available sinceMay 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #2
Plasmid#202519PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorInsertRB1 sgRNA (RB1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hsf-1-sgRNA-B
Plasmid#177787PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hsf-1 promoter)DepositorInserthsf-1 (hsf-1 Nematode)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT9658-sgRNA-mCherry
Plasmid#162987PurposesgRNA cloning plasmidDepositorInsertexchangeable cassette
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3d/LacZ
Plasmid#66201Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorTagsExpressionMutationPromoterAtU3dAvailable sinceAug. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGL3-U6-sgRNA-BFP
Plasmid#107722PurposeFor expression of sgRNA from the U6 promoter with BFP expression simultaneouslyDepositorTypeEmpty backboneUseCRISPRTagsExpressionMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2 EGFP sgRNA2
Plasmid#164933PurposeExpresses EGFP sgRNA2 in mammalian cellsDepositorInsertsgRNA2 targeting Enhanced green fluorescent protein (verified for knockout)
UseLentiviralTagsExpressionMutationPromoterEFS promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBx-Spas-sgRNA-Gm
Plasmid#105232PurposePlasmid containing S. pasteurianus sgRNA with no 20bp target (Empty control) Gentamycin marker for P. aeruginosaDepositorInsertS. pasteurianus sgRNA
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterAvailable sinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDT-sgRNA-XMAS-1x
Plasmid#164413PurposeDual targeted guide and cloning vector. Targets pEF-XMAS-1xStop. Guides targeting endogenous sites can be cloned into BbsI sites.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterU6Available sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
DR274-eGFP sgRNA
Plasmid#61051Purposefor generation of a eGFP specific sgRNA from a T7 promoterDepositorInsertEGFP sgRNA
UseCRISPRTagsExpressionMutationPromoterT7Available sinceFeb. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSCAR_sgRNA_puro-mKate-lox5171
Plasmid#162077Purpose3rd generation lentivirus sgRNA delivery backbone with Cre-removable mKate2 reporter and puromycin resistanceDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralTagsExpressionMammalianMutationPromoterU6, EF1aAvailable sinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
53BP1 N-terminal sgRNA
Plasmid#207091PurposepX330 based plasmid for expression of Cas9 and the GGGGAGCAGATGGACCCTAC sgRNA to target the 53BP1 locus.DepositorInsertGGGGAGCAGATGGACCCTAC
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainTagsExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable sinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-AtU3b/LacZ
Plasmid#66199Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorTagsExpressionMutationPromoterAtU3bAvailable sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBluescriptSKII+ U6-sgRNA(F+E) ACTB
Plasmid#74705PurposeEncodes an sgRNA for spCas9 driven by hU6 promoter with a modified scaffold (Chen et al. Cell 2013) and a spacer targeting the 3'UTR of ACTB mRNADepositorInsertU6 promoter driving sgRNA targeting the 3'UTR of ACTB mRNA
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceApril 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCherry U6-sgRNA (BsmBI)
Plasmid#214128PurposeMammalian continuous expressionDepositorInsertsgRNA
UseLentiviralTagsExpressionMammalianMutationWTPromoterAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-mCherry2-sgRNA (empty)
Plasmid#198330PurposeCustomisable sgRNA sequence with optimised sgRNA scaffold for expression under U6 promoter, with mCherry2 reporterDepositorInsertU6-sgRNA(F+E) empty
UseTagsExpressionMammalianMutationPromoterU6Available sinceApril 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 4
Plasmid#51763PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 4
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
px459-TDP 43 sgRNA2
Plasmid#133763PurposeExpresses Cas9 and human TDP-43 sgRNADepositorInsertTDP-43 (TARDBP Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAcCAST-sgRNA_entry (CJT83)
Plasmid#181785PurposeExpresses AcCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertAcTnsB, AcTnsC, AcTniQ, AcCas12k
UseTagsExpressionBacterialMutationPromoterLac and J23119Available sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCK005_U6-Sp-sgRNA_UP-TdTomato_WPRE
Plasmid#85453PurposeLentiviral CRISPR system backbone bearing BsmBI site for S. pyogenes new guide RNAs and TdTomato.DepositorInsertU6-sgRNA-Backbone-UP-TdTomato
UseCRISPR and LentiviralTagsNLSExpressionMammalianMutationdeletion of AA123-365 in tdTomato (please see dep…PromoterAvailable sinceApril 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
PU6::unc-119_sgRNA
Plasmid#46169Purposeunc-119 targeting sgRNADepositorInsertunc-119 targeting sgRNA (unc-119 Synthetic)
UseCRISPRTagsExpressionMutationPromoterC. elegans U6 snRNA pol III promoterAvailable sinceJuly 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRNA-Lib
Plasmid#53121PurposesgRNA expression construction in a 3rd generation lentiviral backboneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 27, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYLsgRNA-OsU3m/LacZ
Plasmid#66192Purposecloning of sgRNAs for expression in plantsDepositorTypeEmpty backboneUseCloning vectorTagsExpressionMutationPromoterOsU3m (SpeI site destroyed)Available sinceAug. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - EGFP sgRNA 5
Plasmid#51764PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an EGFP targeting synthetic single-guide RNA (sgRNA) element from U6 promoter. Lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
EGFP sgRNA 5
UseCRISPR and LentiviralTagsExpressionMutationPromoterEFS and U6Available sinceMarch 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pShoCAST-sgRNA_entry (BO1)
Plasmid#181786PurposeExpresses ShoCAST. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
UseTagsExpressionBacterialMutationPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
UseTagsExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available sinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR - AAVS1 sgRNA
Plasmid#70661PurposeExpresses human codon-optimized Cas9 protein and puromycin resistance from EFS promoter and an AAVS1-targeting sgRNA element from U6 promoter. Lentiviral backboneDepositorInsertsgRNA against AAVS1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceOct. 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
L4440_BioBrick-hif-1-sgRNA-B
Plasmid#177785PurposeOverexpression of sgRNAs in E. coli HT115 (targeting C. elegans hif-1 promoter)DepositorInserthif-1 (hif-1 Nematode)
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-HypaCas9-RHOA_sgRNA
Plasmid#183878PurposepX459V2.0-HypaCas9 plasmid with RHOA sgRNA for N-terminal tagging of RhoA in human cells.DepositorInsertRHOA sgRNA spacer (RHOA Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330 EGFR-sgRNA
Plasmid#188633PurposeA human codon-optimized SpCas9 and chimeric guide RNA targeting C-terminus of human EGFRDepositorInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet1-sgRNA(siteT9)
Plasmid#154832PurposesgRNA for CRISPR/Cas9-mediated targeted integration into genomic site T9 in CHO cellsDepositorInsertsgRNA(siteT9)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceAug. 25, 2020AvailabilityAcademic Institutions and Nonprofits only