We narrowed to 15,163 results for: GRN
-
Plasmid#36384DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only
-
FUGW U6 gL1HSg2dCas9-KRAB-T2a-GFP
Plasmid#234881PurposeL1HS-silencing plasmid (CRISPRi gRNA2)DepositorInsertLacZ gRNA
UseCRISPR and LentiviralTagsGFPExpressionMammalianAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-V2_hMSH2
Plasmid#186155PurposesgRNA targeting human MSH2 geneDepositorAvailable SinceJuly 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-Puro-sgNUAK2
Plasmid#138693PurposeExpresses a human NUAK2-targeting sgRNA and Cas9DepositorAvailable SinceFeb. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc17a8
Plasmid#124848PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pmTurqoise KIF1A shRNA
Plasmid#102849PurposeGenerates shRNA specific to Rat KIF1A along with cell fill pmTurqoiseDepositorAvailable SinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgCIC-2
Plasmid#74959PurposeCas9 + sgCIC-2 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 shETV1-B
Plasmid#74974PurposeshETV1 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP
Plasmid#84251PurposeExpresses Sp sgCD95-1 gRNA with an EGFP fluorescent markerDepositorInsertSp sgCD95-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSR-puro-Mff1 shRNA
Plasmid#37247DepositorAvailable SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGC(2.1)-U6.3
Plasmid#170516PurposePCR template vector for amplifying gRNAcore(2.1)-pU6.3 promoter fragment; used together with pAC-CR7T-gRNA2.1-nlsBFPDepositorInsertgRNAcore(2.1)-pU6.3
UsePcr template vector for amplifying grnacore(2.1)-…Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMEL14
Plasmid#107920PurposeLEU2 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgSlc18a2
Plasmid#124849PurposeMutagenesis of Slc18a2DepositorInsertSlc18a2 (Slc18a2 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTFE3.1.0-gDNA
Plasmid#112473PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFE3DepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-5
Plasmid#118023PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
PXPR007 sgCIC-1
Plasmid#74953PurposeCas9 + sgCIC-1 with blasticidin selectionDepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgAAVS1(B)
Plasmid#85571PurposeExpresses sgRNA targeting human AAVS1 locusDepositorInsertadeno-associated virus integration site 1 (AAVS1 Human)
ExpressionMammalianAvailable SinceFeb. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-Ehmt1_4
Plasmid#36338DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSIF-H1-hpolb-copGFP
Plasmid#23256DepositorInsertDNA polymerase beta shRNA
UseLentiviral and RNAiTagsGFPAvailable SinceMay 27, 2010AvailabilityAcademic Institutions and Nonprofits only -
3789 pmko-neo RNAi-GFP
Plasmid#8881DepositorInsertGFP
UseRNAi and RetroviralExpressionMammalianAvailable SinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pEasyG1_hph
Plasmid#184912PurposeTemplate to generate via PCR a single gRNA for expression in S. cerevisiaeDepositorInsertgRNA scaffold
UseCRISPRExpressionBacterial and YeastAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0584 huDisCas7-11 S1006-GGGS-D1221 U6-NT guide
Plasmid#186993PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of non-targeting crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, non-targeting crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDAS12342_PEAR-GFP_2in1
Plasmid#177184PurposePEAR-GFP plasmid with a pegRNA that targets its own plasmidDepositorInsertsEGFP split with an intron between amino acids 95-96
pegRNA targeting its own plasmid
UseCRISPRExpressionMammalianMutationdisrupted 5' splice sitePromoterCMV and U6Available SinceFeb. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-LwaCas13acrRNA-BsmBIcassette (LTH151)
Plasmid#171129PurposeLwaCas13a crRNA entry vector for pU6 expression (need to clone in spacer into BsmBI sites)DepositorInsertU6 promoter entry plasmid for LwaCas13a crRNA cloning
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
rAAV-U6-MeCP2shRNA-CamKIIa-mCherry
Plasmid#169704PurposeMeCP2 KnockdownDepositorInsertshRNA against MeCp2 (Mecp2 Mouse)
UseAAVAvailable SinceJune 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
shMEK1/2 v2 puro
Plasmid#72568PurposeHairpin targeting MEK1 and MEK2 (murine).DepositorAvailable SinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSIL-eGFP-shACTN3
Plasmid#52678PurposeshRNA against α-actinin-3 with eGFP transfection markerDepositorAvailable SinceJune 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pResQ shFEN3 3XF-FEN1 D181A
Plasmid#17753DepositorInsertFlap Endonuclease I (FEN1 Human)
UseLentiviral and RNAiTagsTriple FlagExpressionMammalianMutationD181AAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon5
Plasmid#217456PurposeFor TP53 knockout targeting exon 5 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX459-TP53-exon4
Plasmid#217455PurposeFor TP53 knockout targeting exon 4 of TP53DepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shCTRL
Plasmid#181875PurposeExpresses a control shRNA with no known targets in the mouse genome under control of the U6 promoter and mCherry under control of the CaMKIIa promoterDepositorInsertcontrol shRNA with no known targets in the mouse genome
UseAAV, Adenoviral, and Mouse TargetingTagsmCherryExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-DNMT3a ts2
Plasmid#115866PurposeDNMT3a knockdownDepositorAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shOGDH 1714
Plasmid#110941PurposeTet-inducible shRNA targeting OGDHDepositorAvailable SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
L-CRISPR-CTN (MLL-ctrl)
Plasmid#69215PurposeAdvanced lentiviral CRISPR-Cas9 vector for induction of chromosomal translocations; control, MLL-sgRNA + luciferase-sgRNADepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV promoter
P2A-mNeonGreen
UseCRISPR and LentiviralTagsFLAGAvailable SinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC77
Plasmid#62338PurposesgRNA (no RNA aptamer addition) with COM-KRAB effector for mammalian cellsDepositorInsertssgRNA
COM-KRAB
UseLentiviralTagsKRABExpressionMammalianMutationTargets sv40 promoter, sequence: CATACTTCTGCCTGCT…PromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDR366 RNF2
Plasmid#47509Purposehuman gRNA expression vector targeting RNF2DepositorAvailable SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pSicoR (Puro) cRel shRNA2
Plasmid#22510DepositorAvailable SinceFeb. 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Neo/pTER shEGFP#1 (w21-2)
Plasmid#17479Purpose3rd gen lentiviral eGFP shRNA #1 (H1/TO promoter), 3’LTR insertion, NeoDepositorInsertEnhanced green fluorescent protein shRNA #1
UseLentiviral and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLenti X2 Neo/pTER shEGFP#2 (w22-2)
Plasmid#17480Purpose3rd gen lentiviral eGFP shRNA #2 (H1/TO promoter), 3’LTR insertion, NeoDepositorInsertEnhanced green fluorescent protein shRNA #2
UseLentiviral and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shID2 #2
Plasmid#83087PurposeLentiviral shRNA vector for inducible knockdown of human ID2DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
TET-pLKO.1 PURO shSMAD4 #2
Plasmid#83091PurposeLentiviral shRNA vector for inducible knockdown of human SMAD4DepositorAvailable SinceFeb. 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
tet-pLKO shMKP1.v1 puro
Plasmid#87790PurposeExpresses an inducible short hairpin targeting human MKP1 sequenceDepositorAvailable SinceMarch 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-mCherry
Plasmid#75132PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO human shRNA 2 c-MAF
Plasmid#29433DepositorAvailable SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast-cfTuba_1
Plasmid#26717DepositorInsertdog Tuba RNAi (DNMBP C. familiaris (dog RNAi))
UseLentiviral and RNAiExpressionMammalianMutationDog Tuba RNAiAvailable SinceDec. 15, 2010AvailabilityAcademic Institutions and Nonprofits only -
pFIV-H1-Puro-hPolß
Plasmid#18663DepositorInsertshRNA specific to human DNA polymerase beta (POLB Human)
UseLentiviral and RNAiExpressionMammalianMutationnoneAvailable SinceOct. 24, 2008AvailabilityAcademic Institutions and Nonprofits only