171,826 results
-
Plasmid#100890PurposeMammalian expression of PRKACADepositorInsertProtein Kinase CAMP-Activated Catalytic Subunit Alpha (PRKACA Human)
ExpressionMammalianMutationIsoform 1 wild typePromoterCMVAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pB-CAGGS-dCas9-KRAB
Plasmid#110822PurposePiggyBac compatible plasmid expressing dCas9-KRABDepositorInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-SVIP-Strep-HA
Plasmid#113491PurposeExpression of human SVIP with C-terminal strep-HA tagDepositorInsertSVIP (SVIP Human)
Tags2xstrep-HAExpressionMammalianMutationwildtype without stop codonPromoterCMVAvailable SinceAug. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
EXPRESSYALI
Plasmid Kit#1000000245PurposeAssembly of expression constructs for Yarrowia lipolytica.DepositorApplicationCloning and Synthetic BiologyVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
p-dCas9-TET1-Hygro
Plasmid#104404Purposetransient expression of dCas9-TET1 fusion proteinDepositorAvailable SinceApril 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV1A
Plasmid#224437PurposeRep/Cap plasmid for the production of MyoAAV 1A, a muscle-tropic AAV capsid in mice.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDLTTP insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-MYOD1-WT
Plasmid#194570PurposeMammalian Expression of mEGFP-MYOD1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA4/BDD-FVIII
Plasmid#41035DepositorAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.iAChSnFR (AAV1)
Viral Prep#137955-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.CAG.iAChSnFR (#137955). In addition to the viral particles, you will also receive purified pAAV.CAG.iAChSnFR plasmid DNA. CAG-driven iAChSnFR acetylcholine sensor. These AAV preparations are suitable purity for injection into animals.DepositorArticlePromoterCAGAvailable SinceOct. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBPnlsLexA::p65Uw
Plasmid#26230DepositorInsertnlsLexA::p65 (RELA Human)
ExpressionInsectAvailable SinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEVOL_PylRS(WT)-tRNA
Plasmid#223512PurposePylRS (WT)/tRNA Pyl orthogonal pair for genetic code expansion that allows site-specific incorporation of noncanonical amino-acids into a POI using the Amber stop codonDepositorInsertsTags6xHisExpressionBacterialPromoteraraBAD, rrnB, and glnS and proKAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiPVe3_dTomato_nlsdTomato (AAV1)
Viral Prep#213940-AAV1PurposeReady-to-use AAV1 particles produced from pAAV_BiPVe3_dTomato_nlsdTomato (#213940). In addition to the viral particles, you will also receive purified pAAV_BiPVe3_dTomato_nlsdTomato plasmid DNA. Bicistronic expression of dTomato and nuclear-targeted dTomato under the control of the PV+ basket cell-targeting enhancer E3. These AAV preparations are suitable purity for injection into animals.DepositorTagsdTomatoAvailable SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-T2TP
Plasmid#114725Purposeexpression in mammalian cellsDepositorInsertTol2 transposase
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDule-para-aminoPhe
Plasmid#85502PurposePlasmid for incorporating the non-canonical amino acid para-aminoPhe with the Mj pAF synthetase and cognate amber suppressing tRNA in Ecoli.DepositorInsertp-aminoPhe tRNA synthetase and cognate amber suppressing tRNA derived from M. jannaschii Tyrosine synthetase/tRNA system
TagsNoneExpressionBacterialMutationY32T, E107T, D158P, I159L, L162APromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pIVT-dCas9-mCherry
Plasmid#174443Purposein vitro transcription template for dCas9-mCherryDepositorInsertCas9 Endonuclease Dead
UseIn vitro transcription templateTagsmCherryPromoterT7 SP6Available SinceOct. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-APOBEC1-YTHD422N
Plasmid#194432PurposeAPOBEC1 fused to YTHD422NDepositorInsertAPOBEC1-YTHD422N (APOBEC1 Human)
UseCRISPRTagsAPOBEC1-YTHD422N-HAExpressionMammalianMutationD422N mutation in the YTH domain to enhance m6A b…Available SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCSC-ISL1-T2A-LHX3
Plasmid#90215PurposeTo convert human skin fibroblasts into induced motor neurons (hiMN) in combination with NGN2, Sox11, FGF2 and two small molecules, forskolin and dorsomorphin.DepositorAvailable SinceAug. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-axon-jYCaMP1s
Plasmid#135421PurposeAxon-targeted yellow protein calcium sensor expressed under human Synapsin1 promoter, Cre mediated flip-excision switch, for AAV production or direct transfection, slow variantDepositorHas ServiceAAV1InsertjYCaMP1s
UseAAVTagsGAP43 axon targeting sequenceExpressionMammalianPromoterhSynAvailable SinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
Anti-VAPA/B [N479/107R]
Plasmid#188163PurposeMammalian Expression Plasmid of anti-VAPA and -VAPB (Rat). Derived from hybridoma N479/107.DepositorInsertExpressionMammalianPromoterDual CMVAvailable SinceFeb. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF138_pLX307
Plasmid#98368PurposeLentiviral expression of RNF138DepositorAvailable SinceAug. 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pREDawn-AmpR-MCS
Plasmid#188978PurposeFor red light-induced bacterial expression of gene of interest (AmpR)DepositorTypeEmpty backboneExpressionBacterialAvailable SinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
hGli1 flag3x
Plasmid#84922Purposemammalian expression of Gli1DepositorAvailable SinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CROPseq-Guide-Puro-mCherry2
Plasmid#219679PurposeCROPseq vector based on #86708 with an additional mCherry2 fluorescent geneDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsEF1a-Puro-P2A-mCherry2-WPRE-hU6-gRNAExpressionMammalianAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Flag-Smad4
Plasmid#80888Purposemammalian expression of Smad4DepositorAvailable SinceOct. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Rat SARE-Arc Min Promoter-D2GFP-SV40 3'UTR
Plasmid#233058PurposeTo express D2GFP from a Rat SARE-Arc minimal promoter. The Arc gene contains the Rat Arc native SV40 3'UTR containing two intronsDepositorInsertD2GFP (Arc Synthetic, Rat)
UseAAVAvailable SinceAug. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
HisMBP CFlm25
Plasmid#78458PurposeInducible expression in E. coliDepositorInsertHuman Cleavage Factor lm 25 kDa subunit (NUDT21 Human)
TagsHis and MBPExpressionBacterialPromotertacAvailable SinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHel3
Plasmid#102961PurposeE.coli/H.Pylori shuttle vectorDepositorTypeEmpty backboneUseShuttle vectorAvailable SinceNov. 28, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAMS823 His6-MBP-3C-ORF2p (238-1061, ORFeus-Hs) in pET41
Plasmid#213024PurposeExpresses human LINE-1 ORF2p Core (238-1061) in E. coli as an N-MBP fusionDepositorInsertLINE-1 ORF2p (238-1061)
TagsHis6-MBP-3CExpressionBacterialPromoterT7 / LacAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEf1a-goldDn29-dCas9-P2A-GFP
Plasmid#247157PurposeMammalian expression of a human codon optimized engineered goldDn29 recombinase fused to dCas9 and gRNA expression cassette for targeting attH1 with H1-g3DepositorInsertgoldDn29-dCas9-P2A-GFP
TagsSV40 NLSExpressionMammalianMutationM6I/E70G/A224P/G227V/Q332K/N341K/L393P/D503NPromoterEf1aAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJH4687
Plasmid#200783PurposePnpr-4 ins-22::pHluorin unc-54 3' UTR C.elegans AVA and other neurons expression of ins-22 pHluorinDepositorAvailable SinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cas9-sgRNA-A
Plasmid#149369PurposeExpresses SpCas9 and sgRNA targeting the lenti-CDDR reporterDepositorInsertsCas9
sgRNA-A
Puromycin resistance
UseCRISPRTags3xFLAG, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianPromoterCBh, PGK, and U6Available SinceNov. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pQmod2S-GG
Plasmid#191346PurposeClostridium expression vector (pBP1 origin, specR) with drop-out Plac-RFP cassette flanked with BsaI sitesDepositorInsertPlac-RFP (IPTG-inducible red fluorescent protein)
ExpressionBacterialPromoterPlacAvailable SinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA4-CTCF-3p-UTR
Plasmid#195106PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA3-CTCF-3p-UTR
Plasmid#195105PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting downstream of the human CTCF 3'UTR. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF 3' UTR region
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Alpha 5 integrin-GFP
Plasmid#15238DepositorAvailable SinceSept. 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-EF1aL-WT_ABCA3-GFP
Plasmid#188548PurposeLentiviral vector allowing for EF1aL-driven constitutive expression of wildtype human ABCA3:GFP fusion proteinDepositorAvailable SinceOct. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_Zika_Flag_NS1 (Variant: W98G)
Plasmid#79633PurposeThird generation Self-inactivating lentivector expressing NS1 (Variant W98G) from Zika virusDepositorInsertNS1
UseLentiviralTagsFlagExpressionMammalianMutationVariant: W98GPromoterEF1Available SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBA-mCherry-EGFP-PIM
Plasmid#111758PurposeLow level expression of mCherry-EGFP-PIM. Can be used for inducible aggregate formation upon AP20187 additionDepositorInsert2x FKBP homo-mCherry-EGFP-2x FKBP homo-2x FKBP
ExpressionMammalianMutationVal24Glu, Tyr80Cys, Ala95Thr mutations in second …Promoterchicken beta-actinAvailable SinceOct. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-U6-EMX1
Plasmid#140581PurposeExpresses a gRNA and mCherry in mammalian cellsDepositorInsertgRNA EMX1
UseCRISPRAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ZnGreen2
Plasmid#170781Purposecytosolic ZnGreen2 zinc sensor with 20 uM KdDepositorInsertZnGreen2
ExpressionMammalianPromoterCMVAvailable SinceOct. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-tTA
Plasmid#104109PurposeAAV-mediated expression of tTA under the Syn1 promoter.DepositorInserttTA2
UseAAVPromoterhSyn1Available SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-nbOcIgG-DddA11_NT
Plasmid#232441PurposeAnti-rabbit IgG Fc specific nanobody-DddA11_NT for D&Dseq (sc TFs molecular footprint)DepositorInsertnbOcIgG-DddA11_N
Available SinceFeb. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MZB209
Plasmid#228492PurposeBirA encoded pACYC vector for co-expression with Avi-tagged constructs (Bacterial Expression)DepositorAvailable SinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_MMP-9-HA
Plasmid#121172PurposeExpression of mouse MMP9DepositorInsertMMP9 (matrix metallopeptidase 9) (Mmp9 Mouse)
TagsHAExpressionMammalianMutationSee depositor comments belowPromoterCMV immediate/earlyAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRDA_336
Plasmid#179095PurposeBE Cas expressionDepositorInsertBE3.9 (Cas9-NG)
UseCRISPR and LentiviralAvailable SinceJan. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
c-Rel cFlag pcDNA3
Plasmid#20013DepositorAvailable SinceJan. 28, 2009AvailabilityAcademic Institutions and Nonprofits only -
sfGFP-Caveolin-C-10
Plasmid#56366PurposeLocalization: Membrane, Excitation: 485, Emission: 507DepositorAvailable SinceJan. 13, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUK21
Plasmid#49788PurposeE. coli cloning vector (KanR, high copy, blue/white selection, M13 IR)DepositorTypeEmpty backboneUseCloning vectorPromoterlacZAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-Positron2-ST-WPRE
Plasmid#239080PurposeAAV-mediated expression of positive-going voltage sensor under the Syn promoter, Cre-dependent expression; soma localization targeting sequenceDepositorInsertPositron2-ST
UseAAV and Cre/LoxTagssoma localization targeting sequenceExpressionMammalianMutationR78K N81D D92N W178FPromoterhSynapsin1Available SinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only