20,802 results
-
Viral Prep#87306-AAV1PurposeReady-to-use AAV1 particles produced from AAV pEF1a-DIO-FLPo-WPRE-hGHpA (#87306). In addition to the viral particles, you will also receive purified AAV pEF1a-DIO-FLPo-WPRE-hGHpA plasmid DNA. EF1a-driven, Cre dependent expression of the site-specific recombinase FlpO. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only
-
BFP-KDEL
Plasmid#49150Purposevisualization of the ERDepositorAvailable SinceMay 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
mCherry2-C1
Plasmid#54563PurposeLocalization: C1 Cloning Vector, Excitation: 587, Emission: 610DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsmCherry2ExpressionMammalianAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDG459
Plasmid#100901PurposeSpCas9 with 2A-Puro and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAG and T2A-PuroRExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 FLII12Pglu-700uDelta6
Plasmid#17866DepositorInsertFLII12Pglu-700uDelta6
TagsCitrineExpressionMammalianMutation700uDelta6, ECFP insert in mglBAvailable SinceApril 29, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
phMYT1L-N174
Plasmid#66809Purpose2nd generation lentiviral transfer plasmid. Expresses human MYT1L with G418 resistanceDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pIRES-EGFP-puro
Plasmid#45567DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsIRES-EGFP-PuroExpressionMammalianPromoterPhcmv (strong human cytomegalovirus immediate ear…Available SinceJune 14, 2013AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(4)P Probe
Plasmid#211509PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-4-Phosphate (PI(4)P) from bacteriaDepositorInsertSidC (P4C)
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
phDLX1-N174
Plasmid#60859Purpose2nd generation lentiviral transfer plasmid. Expresses DLX1 under the EF1a promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
6xHis-SNAP-PI(3)P Probe
Plasmid#211508PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3-Phosphate (PI(3)P) from bacteriaDepositorAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCbs FlagOmomyc
Plasmid#113168PurposeExpression of FLAG tagged Omomyc in mammalian cellsDepositorAvailable SinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
H2B-mGreenLantern
Plasmid#164464PurposeLocalization of mGreenLantern fluorescent protein to histone 2BDepositorInsertmGreenLantern
TagsHuman Histone 2B (D26G and V119I mutations)ExpressionMammalianMutationClover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L2…PromoterCMVAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL4.10/RSV_SF3B3-miniXon_Luciferase
Plasmid#174660PurposePlasmid containing the SF3B3-miniXon/Firefly luciferase cassette. Translation of Firefly luciferase is controlled by splicing modulation of the SF3B3-miniXon by LMI070.DepositorInsertminiXon cassette
UseLuciferaseExpressionMammalianMutationKozak ATG initiation sequence in middle exonPromoterRSVAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
GAL4UAS-Luciferase reporter
Plasmid#64125PurposePhotoactivatable transcription system. Luciferase reporter under the control of the upstream activator sequence (UAS) of Gal4.DepositorInsertGAL4UAS
UseLuciferaseTagsluciferaseExpressionMammalianPromoterGAL4UASAvailable SinceApril 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 1
Plasmid#183828PurposeExpress EML4-ALK fusion variant 1 (E13;A20) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-13 and ALK exon…ExpressionMammalianPromoterCMVAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDG458
Plasmid#100900PurposeSpCas9 with 2A-EGFP and a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.DepositorInsertshumanized CRISPR associated protein 9
U6-gRNA scaffold 1
U6-gRNA scaffold 2
UseCRISPR and Mouse TargetingTags3xFLAGExpressionMammalianPromoterCBh and U6Available SinceDec. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-EML4-ALK variant 3a
Plasmid#183829PurposeExpress EML4-ALK fusion variant 3a (E6a;A20) in mammalian cellsDepositorUseLentiviralTagsThe fusion protein of EML4 exon 1-6a and ALK exon…ExpressionMammalianPromoterCMVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/Flag-WTAP
Plasmid#53741PurposeFor expression of WTAP (Wilms tumor 1 associated protein) in human cellsDepositorAvailable SinceOct. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
phDLX2-N174
Plasmid#60860Purpose2nd generation lentiviral transfer plasmid. Expresses DLX2 under the EF1a promoterDepositorAvailable SinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-C1
Plasmid#54743PurposeLocalization: C1 Cloning Vector, Excitation: 493, Emission: 509DepositorTypeEmpty backboneTagsmWasabiExpressionMammalianAvailable SinceJune 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154951-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available SinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDest eGFP MBNL1 42 kDa
Plasmid#61277PurposeMammalian expression of EGFP-tagged human MBNL1DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pX165-HiFi Cas9
Plasmid#140563PurposeExpresses HiFi Cas9 in mammalian cellsDepositorInsertCas9
MutationR691AAvailable SinceMay 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pmCTIP2-N106
Plasmid#66808Purpose2nd generation lentiviral transfer plasmid. Expresses mouse CTIP2 with blasticidin resistanceDepositorAvailable SinceSept. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
AnkyrinG-190-GFP
Plasmid#31059DepositorAvailable SinceFeb. 28, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-gfp[tagless]
Plasmid#40164DepositorInsertPromotor probe
Available SinceDec. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pIRES Centrin1 mCherry
Plasmid#64338PurposeBicistronic expression of mCherry-Centrin1 fusion and Hygro resistance geneDepositorInsertCentrin1
TagsIRES-Hygro and mCherryExpressionMammalianPromoterCMVAvailable SinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-ROR1
Plasmid#116789PurposeLentiviral expression of ROR1DepositorAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMT413
Plasmid#8606DepositorInsertbarnase, barstar
TagsphoA signal sequence to barnaseExpressionBacterialAvailable SinceJan. 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
hMLKL NB(1-182)-2xFv-Venus
Plasmid#106077Purposeexpression in mammalian cellsDepositorInserthuman MLKL NB(1-182)-2xFv-Venus (MLKL Human)
UseRetroviral; Tet-on retrovirusTagsVenusExpressionMammalianMutationamino acids 1-182PromoterDox-inducibleAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
mNeptune-pBAD
Plasmid#54714PurposeLocalization: Protein Expression Vector , Excitation: 600, Emission: 650DepositorTypeEmpty backboneTags6xHis and mNeptuneExpressionBacterialAvailable SinceJuly 25, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX459V2.0-SpCas9-HF1
Plasmid#108293PurposepX459 V2.0 (Plasmid #62988) with the N497A, R661A, Q695A, and Q926A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
mWasabi-N1
Plasmid#54765PurposeLocalization: N1 Cloning Vector, Excitation: 493, Emission: 509DepositorTypeEmpty backboneTagsmWasabiExpressionMammalianAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry (AAV9)
Viral Prep#50474-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA. hSyn-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE (AAV8)
Viral Prep#130995-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE (#130995). In addition to the viral particles, you will also receive purified pAAV-hSyn-ChRmine-mScarlet-Kv2.1-WPRE plasmid DNA. hSyn-driven, soma-targeted ChRmine-mScarlet expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmScarletAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.Cre.WPRE.hGH (AAV Retrograde)
Viral Prep#105553-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pENN.AAV.hSyn.Cre.WPRE.hGH (#105553). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.Cre.WPRE.hGH plasmid DNA. hSyn-driven Cre expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
[#GS5-RV] MitoTRACER-Donor
Plasmid#233505PurposeRetroviral construct of the MitoTRACER genetic reporter to be expressed in the donor cellsDepositorInsertMitoTRACER-Donor
UseRetroviral and Synthetic BiologyTagsGFP11 and HA TagExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-EYFP (AAV9)
Viral Prep#26973-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hChR2(H134R)-EYFP (#26973). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-EYFP plasmid DNA. hSyn-driven, humanized channelrhodopsin H134R mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEYFPAvailable SinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV(CAT)T7-SB100
Plasmid#34879DepositorInsertSB100X transposase
ExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LC3-RFP-LC3ΔG
Plasmid#168997PurposeExpresses GFP-LC3-RFP-LC3ΔG in mammalian cells and zebrafish to measure autophagic fluxDepositorInsertmicrotubule-associated protein 1 light chain 3 beta (Map1lc3b Rat)
TagsEGFP and mRFP1ExpressionMammalianAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
[#GS7-LV] DsRed GFP TEVp Zeo Switch - Recipient
Plasmid#233507PurposeLentiviral construct for the MitoTRACER genetic reporter to be expressed in the recipient cellsDepositorInsertDsRed loxP eGFP
UseLentiviral and Synthetic BiologyExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-GFP
Plasmid#171123PurposeDoxycycline inducible expression of GFPDepositorInsertEGFP
UseLentiviralExpressionMammalianPromoterTRE3GSAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmiRFP680-N1
Plasmid#136557PurposeA cytoplasmic expression of a monomeric phytochrome-based near-infrared fluorescent protein miRFP680 (another name miRFP713V254C)DepositorInsertmiRFP680
ExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCHAC-mt-mKeima
Plasmid#72342Purposeretrovirus construct for stable expressing mt-mKeimaDepositorInsertmt-mKeima
UseRetroviralAvailable SinceJan. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV Retrograde)
Viral Prep#44361-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-Mfn1
Plasmid#141154PurposeMammalian expression and labeling mitofusin 1DepositorAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UAS-Luciferase
Plasmid#104840PurposeSPARK reporter geneDepositorInsertLuciferase
UseAAVExpressionMammalianPromoterUASAvailable SinceJan. 6, 2018AvailabilityAcademic Institutions and Nonprofits only