179,463 results
-
Plasmid#127663PurposeOver-express EGFP-IRF3DepositorAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
Mm-PylRS-AF/Pyl-tRNACUA
Plasmid#122650PurposetRNA synthetase/tRNA pair for the incorporation of unnatural amino acid into proteins in mammalian cells in response to the amber codon TAG.DepositorInsertPylRS-AF, Pyl-tRNACUA
TagsFLAGExpressionMammalianMutationTyrosine 306 changed to Alanine, Tyrosine 384 cha…Available sinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (AAV1)
Viral prep#104493-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP7b-WPRE (#104493). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7b-WPRE plasmid DNA. Synapsin-driven, Cre-dependent jGCaMP7b expression. jGCaMP7b exhibits the brightest resting fluorescence and can be used for imaging of small neuronal processes (dendrites and axons). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1-pCMV-PfV-GS-Sapphire
Plasmid#116933PurposeMammalian vector for expression of the 40nm GEMDepositorInsertPfv
TagsSapphireExpressionMammalianPromoterCMVAvailable sinceDec. 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti6.2_miRFP670
Plasmid#113726PurposeExpresses the fluorescent protein miRFP670 in a lentiviral backboneDepositorInsertmiRFP670
UseLentiviralExpressionMammalianPromoterCMVAvailable sinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
T444T
Plasmid#113081PurposeEnhanced RNAi vector for C. elegans. Contains two T7 polymerase termination sequences adjacent to the T7 promoter sites.DepositorTypeEmpty backboneUseRNAiExpressionBacterialAvailable sinceSept. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (AAV Retrograde)
Viral prep#104492-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pGP-AAV-syn-FLEX-jGCaMP7f-WPRE (#104492). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP7f-WPRE plasmid DNA. Syn-driven, Cre-dependent GCaMP7f calcium sensor. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.DepositorPromoterSynAvailable sinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK DEST H2B-iRFP670
Plasmid#90237PurposeLentiviral vector to express H2B-iRFP670 under PGK promoterDepositorInsertH2B
UseLentiviralTagsiRFP670ExpressionMammalianPromoterPGKAvailable sinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEGFP-VSP4-E228Q
Plasmid#80351PurposeExpression of GFP-tagged, dominant negative VPS4 mutantDepositorAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKIR1.1
Plasmid#85758PurposeCRISPR/Cas9 in Arabidopsis with seed a fluorescent reporterDepositorInserthuman-codon-optimized SpCas9
UseCRISPRTagsFLAGExpressionPlantPromoterAtRPS5AAvailable sinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
hCRISPRa-v2, genome-wide, top 5 sgRNAs/gene
Pooled library#83978PurposeVersion 2 of the human CRISPRa genome wide libraryDepositorUseLentiviralAvailable sinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY109 (lenti-LbCpf1)
Plasmid#84740PurposeLenti virus delivery of LbCpf1 and crRNA guideDepositorInsertshuLbCpf1
puromycin resistance gene
UseLentiviralTags3xHA, NLS, and P2APromoterEFSAvailable sinceNov. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Human genome-wide lentiviral CRISPR gRNA library version 1
Pooled library#67989PurposeKnockout library targeting 18,010 human genes. gRNAs were improved using a new design pipeline and improved gRNA scaffold.DepositorSpeciesHomo sapiens, Mus musculus, and SyntheticUseCRISPR and LentiviralAvailable sinceOct. 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMXs-3XFLAG-EGFP-OMP25
Plasmid#83354PurposeFor tagging mitochondria with Sigma FLAG epitopesDepositorInsert3XFLAG-EGFP-OMP25
UseRetroviralExpressionMammalianAvailable sinceSept. 26, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pICE-HA-MRE11-WT
Plasmid#82033PurposePlasmid for constitutive or doxycycline-inducible expression of wild-type human MRE11. Confers resistance to puromycin. Use T-REx cells for doxycycline-inducible expression.DepositorAvailable sinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCIP-Flag-TfebAA
Plasmid#79014PurposeFor mammalian expression of a Flag-tagged, constitutively active version (S142A, S211A) of Tfeb.DepositorAvailable sinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV-OptoSTIM1
Plasmid#70159PurposeMammalian expression plasmid of OptoSTIM1 (optogenetically-activated STIM1 protein)DepositorAvailable sinceNov. 2, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1 phiC31
Plasmid#68310PurposeIn vitro transcription vector to generate phiC31 mRNA (i.e. for zebrafish injection).DepositorInsertphiC31
UseRna transcriptionPromoterCMVAvailable sinceAug. 27, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
APEX2 - Actin in pEGFP
Plasmid#66172PurposeAPEX2 fused to the N-terminus of human beta actinDepositorInsertAPEX2 - human beta Actin (ACTB Synthetic, Human)
TagsFlag epitope tag (DYKDDDDK)ExpressionMammalianMutationAPEX2 contains 4 mutations relative to wt soybean…PromoterCMVAvailable sinceJuly 21, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
mCitrine-N1
Plasmid#54594PurposeLocalization: N1 Cloning Vector, Excitation: 516, Emission: 529DepositorTypeEmpty backboneTagsmCitrineExpressionMammalianAvailable sinceJune 12, 2014AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pMLS-SV40-EGFP
Plasmid#46919PurposeTarget EGFP gene that is stably integrated into HEK293 genomeDepositorInsertGFP
UseCRISPR and RetroviralExpressionMammalianPromoterSV40Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Cas9m4
Plasmid#47316PurposeCas9 D10A+D839A+H840A+N863ADepositorInsertCas9m4
UseCRISPRAvailable sinceSept. 4, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pRSET-mSA-EGFP
Plasmid#39862DepositorInsertmonomeric streptavidin fused to EGFP
Tags6xHis, EGFP, and FLAGExpressionBacterialPromoterT7Available sinceMarch 15, 2013AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p18sheLL
Plasmid#37321DepositorInsertHPV18L1+L2
ExpressionMammalianPromoterCMVAvailable sinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits onlyCited by -
FR_HNF4A2
Plasmid#31100DepositorAvailable sinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pNH-TrxT
Plasmid#26106PurposeSGC Empty backbone for bacterial expressionDepositorTypeEmpty backboneTags6xHis, TEV cleavage site, and TrxAExpressionBacterialPromoterT7-lacO (lactose/IPTG inducible)Available sinceDec. 2, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
CaV2.1 (pcDNA6)
Plasmid#26578DepositorAvailable sinceNov. 29, 2010AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Flag-HA-USP13
Plasmid#22568DepositorPublicationAvailable sinceDec. 4, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Flag-HA-USP20
Plasmid#22573DepositorPublicationAvailable sinceNov. 16, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAc5.1B-EGFP
Plasmid#21181DepositorInsertenhanced green flourescent protein
UseDrosophila expressionAvailable sinceJune 23, 2009AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GST-Pin1
Plasmid#19027DepositorAvailable sinceAug. 25, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pWZL hygro H-Ras V12
Plasmid#18749DepositorPublicationAvailable sinceJuly 3, 2008AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSOUP
Plasmid#165419PurposeThe pSOUP helper plasmid needed for replication of all pGreen (Hellens et al., 2000) based vectors in AgrobacteriumInsertRep A
UseHelper plasmid required for replication for all p…Available sinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-hSyn-FLEX-TeLC-P2A-dTomato
Plasmid#159102PurposeCre-dependent tetanus toxin light chain construct with nuclear-localized dTomato fluorophore for conditional silencing of neurons.DepositorInsertTeLC-P2A-NLS-dTomato
UseAAVPromoterhSynapsinAvailable sinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBA904
Plasmid#122238PurposeLentiviral CRISPR guide vector expressing a eGFP-NT2 sgRNA with cs1 incorporated in the loop of the sgRNA constant region.DepositorInsertsgRNA with cs1 in stem loop 2 of the constant region
UseCRISPR and LentiviralExpressionMammalianAvailable sinceApril 21, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3.1-SARS-Spike
Plasmid#145031PurposeExpress SARS-CoV spike protein with C9 tag at C-terminal in mammalian cellsDepositorInsertSARS-CoV Spike (S Synthetic)
TagsC9 and CD5 signal peptideExpressionMammalianPromoterCMVAvailable sinceApril 16, 2020AvailabilityIndustry, Academic Institutions, and NonprofitsCited by -
pCMV-T7-ABEmax(7.10)-SpG-P2A-EGFP (RTW4562)
Plasmid#140002PurposeCMV and T7 promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with SpG(D10A/D1135L/S1136W/G1218K/E1219Q/R1335Q/T1337R) and P2A-EGFPDepositorInserthuman codon optimized ABEmax(7.10) SpCas9 variant named SpG with P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsP2A-EGFPExpressionMammalianMutationnSpCas9=D10A; SpG=D1135L/S1136W/G1218K/E1219Q/R13…PromoterCMV and T7Available sinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
ER-mNeonGreen
Plasmid#137804PurposeVisualization of the Endoplasmic ReticulumDepositorInsertKDEL
ExpressionMammalianPromoterCMVAvailable sinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLJM1-Tmem192-mRFP-3xHA
Plasmid#134631Purposebait for affinity-isolation of lysosomesDepositorAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAG153 FKBP-CFAST11
Plasmid#130813PurposeExpresses FKBP-CFAST11 in mammalian cellsDepositorInsertFKBP-CFAST11
TagsMyc-tagExpressionMammalianPromoterCMVAvailable sinceSept. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
24xMoonTag-kif18b-24xPP7 (MoonTag translation reporter)
Plasmid#128604PurposeExpresses 24xgp41 peptide array (MoonTag peptide array), followed by kif18b gene and 24 repeats of PP7 hairpins in 3’ UTR.DepositorAvailable sinceAug. 12, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
4xmts-mNeonGreen
Plasmid#98876PurposeIn vivo visualization of mitochondria (can be used for colocalization studies)DepositorInsert4xmts
TagsmNeonGreenExpressionMammalianPromoterCMVAvailable sinceMarch 7, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV CMV-dSaCas9-KRAB-bGHpA
Plasmid#106219PurposeAAV expressing deactivated S. aureus Cas9 fused to a KRAB repressorDepositorInsertdead S. aureus Cas9 KRAB
UseAAV and CRISPRTagsHA-NLSExpressionMammalianMutationD10A and N580APromoterCMVAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TurboID-V5_pRS415
Plasmid#107167Purposeexpresses V5-tagged TurboID in the yeast cytosolDepositorInsertTurboID (BirA mutant)
ExpressionYeastMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…Available sinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
S1030
Bacterial strain#105063Purposehost strain for phage assisted continuous evolutionDepositorBacterial resistanceStreptomycin and TetracyclineAvailable sinceMarch 21, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
TRE-KRAB-dCas9-IRES-GFP
Plasmid#85556Purpose2nd generation lentiviral vector expressing a KRAB-dCas9 fusion protein and GFPDepositorPublicationInsertKRAB-dCas9-IRES-GFP
UseCRISPR and LentiviralTags2x NLS, HA Tag, and KRAB domainExpressionMammalianPromoterTRE3GAvailable sinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-U6-sgRNA-hSyn-mCherry
Plasmid#87916PurposesgRNA expressing AAV construct with a mCherry reporter driven by hSyn promoter. (replaced the GFP in pX552 from Zhang lab with mCherry)DepositorInsertmCherry
UseAAV and CRISPRExpressionMammalianPromoterhSynAvailable sinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR-PP7-2xmCherry-CAAX
Plasmid#74925PurposeExpresses PP7-2xmCherry-CAAXDepositorInsertPP7-2xmCherry-CAAX
UseLentiviralExpressionMammalianAvailable sinceApril 29, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by