We narrowed to 10,763 results for: ESP
-
Plasmid#171071PurposeA COSMO mutant (Y34F) responds to caffeine to induce dimerization of a phospholipid-binding polybasic domain with subsequent plasma membrane translocation.DepositorInsertanti-caffeine nanobody variant
Tagsmodified STIM1–PB tagExpressionMammalianMutationY34FPromoterCMVAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP–acVHH (Y104F)–PB
Plasmid#169683PurposeA COSMO mutant (Y104F) responds to caffeine to induce dimerization of a phospholipid-binding polybasic domain with subsequent plasma membrane translocation.DepositorInsertanti-caffeine nanobody variant
Tagsmodified STIM1–PB tagExpressionMammalianMutationY104FPromoterCMVAvailable SinceJuly 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAA2
Plasmid#154162PurposeFirefly luciferase under the control of 4 copies of: the enhancer for the Drosophila melanogaster Metchnikowin gene, 4 Rel1A-specific NF-_B sites, 3 GATA sites and 3 putative ecdysone-response elements, plus an additional NF-_B site.DepositorInsertFirefly luciferase
UseLuciferaseMutation16 wt NF-κB sites were replaced with Rel1A-specif…Available SinceAug. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAA1
Plasmid#154161PurposeFirefly luciferase under the control of 3 copies of: the enhancer for the Drosophila melanogaster Metchnikowin gene, 4 Rel1A-specific NF-_B sites, 3 GATA sites and 3 putative ecdysone-response elements, plus an additional NF-_B site.DepositorInsertFirefly luciferase
UseLuciferaseMutation12 wt NF-κB sites were replaced with Rel1A-specif…Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM62
Plasmid#154160PurposeFirefly luciferase under the control of the enhancer for the Drosophila melanogaster Metchnikowin gene, with 4 Rel2-specific (VII) NF-_B sites, 3 GATA sites and 3 putative ecdysone-response elements, plus an additional NF-_B site.DepositorInsertFirefly luciferase
UseLuciferaseMutation4 wt NF-κB sites were replaced with Rel2-specific…Available SinceAug. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-CBX1mut-Dronpa
Plasmid#138250PurposeTriple-mutant CBX1 chromodomain (residues 20-73) tagged with reversibly switchable FP Dronpa. Mutations V3E/K6E/D40S correspond to positions V22/K25/D59 in full-length CBX1.DepositorInsertCBX1mut-Dronpa
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceJuly 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-MutY-pKK223
Plasmid#131376PurposeLow level expression of E.coli G.stearothermophillus MutY chimera proteinDepositorInsertEcNGsC MutY chimera
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET28a_6HT-TBP6.7(Q54A)
Plasmid#112730PurposeAlthough not evolved, this residue within TBPs participates in stabilizing the polypeptide loop responsible for RNA recognition.DepositorInsert6His-TEV-TBP6.7(Q54A)
Tags6His-TEVExpressionBacterialMutationQ54APromoterT7Available SinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
GST-RP2-C86Y,P95L
Plasmid#86074PurposeA bacterial expression plasmid encoding ciliary localization effected RP2 (RP2-C86Y,P95L) with N-terminus GST-tag.DepositorInsertRP2 (RP2 Human)
TagsGSTExpressionBacterialMutationChanged cysteine-86 and proline-95 to tyrosine an…PromotertacAvailable SinceMay 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO CD16.7-h-PKD1 FLM (4078-4169)
Plasmid#83463PurposeCytoplasmic tail of human PC1 expression cassette with a membrane anchor and PKD1 sequence that corresponds to 4078 to 4169 of PC1 (96)DepositorAvailable SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pVH003
Plasmid#80397PurposeContains pBAD-CusR (response regulator) and pCusR-antiscaffold-YFP-AAV. This plasmid was used for microscopy tracking experimentsDepositorUseSynthetic BiologyTagsFused by GS linker to LZx domain and Venus has N-…ExpressionBacterialAvailable SinceSept. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTH394-SUP45-L34S
Plasmid#29373DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationL34S mutant gene (corresponding to the sup45-36ts…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTH401-SUP45-R65C
Plasmid#29381DepositorInsertSUP45 gene encoding translation release factor 1 from S. cerevisiae (SUP45 Budding Yeast)
ExpressionYeastMutationR65C mutant gene (corresponding to the sup45-3 al…Available SinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE5
Plasmid#169263PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 5DepositorInsertNop4 delta E5 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 5PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
p414GPD-3xFLAG-Nop4 dE8
Plasmid#169264PurposeS. cerevisiae (yeast) vector for constitutive expression of 3xFLAG-Nop4 delta Exon 8DepositorInsertNop4 delta E8 (NOP4 Budding Yeast)
Tags3xFLAGExpressionYeastMutationdeleted region corresponding to human Exon 8PromoterGPDAvailabilityAcademic Institutions and Nonprofits only -
pLV-8xGTIIC-mScarlet-NLS-PEST
Plasmid#249724PurposeNuclear-localized fluorescent reporter of YAP/TAZ activity driven by promoter with TEAD binding sitesDepositorInsertYAP-TEAD responsive promoter (YAP1 Human)
UseLentiviralTagsmScarlet3-NLS-PESTExpressionMammalianAvailable SinceFeb. 20, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244092PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mRuby3
Plasmid#244101PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244084PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.GFAP.(mem).iGlucoSnFR2.mRuby3
Plasmid#244089PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX_305_Ovalbumin
Plasmid#184924PurposeLentiviral vector for expressing Ovalbumin. Also expresses the puromycin resistance gene as a selectable marker.DepositorInsertOvalbumin (OVAL Chicken)
UseLentiviralExpressionMammalianMutationOur vector has an A188T mutation that does not im…PromoterPGKAvailable SinceFeb. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-pAce-Kv2.1PR
Plasmid#195523PurposeGreen fluorescent, positive response-polarity voltage indicator under the control of synapsin promoter; soma-targetedDepositorInsertpAce-Kv2.1 proximal restriction sequence
UseAAVExpressionMammalianMutationAce-mNeon 78K, 81D, 92N, 178F; SY linkerPromoterSynapsinAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-mScarlet-Frame1-Parental-Minicircle
Plasmid#216125PurposeParental minicircle containing mScarlet-I flanked by a splice acceptor and splice donor. Used with other intron tagging plasmids for placing the mScarlet tag as a synthetic exon into frame 1 introns of target genes.DepositorInsertsgRNA-SA-(GGGGS)x4-mScarlet-I-(GGGGS)x4-SD
UseCRISPRAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-SRRM2-mCherry
Plasmid#174089PurposeInducibly expresses SRRM2-mCherry in mammalian cells with the Tet-on systemDepositorAvailable SinceSept. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ERT2-iCre-ERT2
Plasmid#178059PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under Syn promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman synapsin 1 (Syn) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UBC-ERT2-iCre-ERT2
Plasmid#178060PurposeConditionally active form of Cre recombinase (activated in response to tamoxifen) under UBC promoter.DepositorInsertERT2-iCre-ERT2
UseAAVExpressionMammalianPromoterHuman ubiquitin C (UBC) promoterAvailable SinceOct. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-HRE-dUnaG
Plasmid#124372PurposeUnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signalingDepositorInsertHRE-dUnaG
UseLentiviralTagsPEST-degron and Myc tagPromoterHRE (HIF responsive element 5x + CMV minimal prom…Available SinceJuly 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.1.t1
Plasmid#73547PurposetRNA synthetase/tRNA pair for the in vivo incorporation of p-azido-l-phenylalanine, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.1.t1
pAzFRS.1.t1
ExpressionBacterialAvailable SinceMarch 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R172H
Plasmid#14854DepositorInsertp53 R172H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationStructural mutant R172H. (Murine p53 codon 172 co…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1b-ST-WPRE
Plasmid#214967PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for brighter fluorescenceDepositorInsertCepheid1b-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-Cepheid1s-ST-WPRE
Plasmid#214968PurposeRed fluorescent, negative response-polarity voltage indicator under the control of synapsin promoter; soma-targeted; for better photostabilityDepositorInsertCepheid1s-ST
UseAAVPromoterhuman SynapsinAvailable SinceMarch 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-CMV-GRAB_LoX3-mut
Plasmid#234651PurposeThis plasmid encodes a mutated version of the genetically encoded chemokine biosensor LoX3-1.0, which is designed to be non-responsive to chemokine binding.DepositorInsertGPCR activation-based mutant chemokine CXCL9-11 sensor GRAB_LoX3-mut
ExpressionMammalianPromoterCMVAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lox-stop-Lox p53 R270H
Plasmid#14853DepositorInsertp53 R270H (Trp53 Mouse)
UseCre/LoxTagsLox-STOP-loxExpressionMammalianMutationContact mutant R270H. (Murine p53 codon 270 corre…Available SinceApril 27, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAzFRS.2.t1
Plasmid#73546PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAzFRS.2.t1
pAzFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
XRE-H2B-eGFP
Plasmid#182294PurposeFluorescent reporter for AhR activityDepositorAvailable SinceOct. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(mem).iGlucoSnFR2.mIRFP670nano3
Plasmid#244102PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mIRFPDepositorInsertiGlucoSnFR2.mIRFP670nano3
UseAAVTagsIgG kappa leader and mIRFP670nano3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNTI647 dCas9-Mxi1 TetR KanMX
Plasmid#139474PurposeIntegrates CRISPRi effector and tet-responsive regulatorDepositorInsertsdCas9-Mxi1
Tet Repressor
UseCRISPRTagsMxi1 and NLSExpressionYeastMutationD10A, H840APromoterpGPM1 and pTEF1Available SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pANAP-P2A-eRF(E55D)
Plasmid#241290PurposeAllows co-translational incorporation of the fluorescent ncAA Anap directly into the target protein; expresses tRNACUA-Leu, AnapRS, and dominant negative ribosomal release factorDepositorInsertthe amber suppressor tRNACUA-Leu
ExpressionMammalianMutationmutant E.coli leucyl synthetase specific for Anap…PromoterCMVAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.HaloTag
Plasmid#244094PurposeCytosolic expression of green glucose sensor with non-responsive HaloTagDepositorInsertiGlucoSnFR2.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(cyto).iGlucoSnFR2.H348H.HaloTag
Plasmid#244095PurposeCytosolic expression of green glucose sensor (high affinity) with non-responsive HaloTagDepositorInsertiGlucoSnFR2.H348H.HaloTag
UseAAVTagsHaloTagAvailable SinceSept. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP PuroR
Plasmid#128958PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Dox-Akt
Plasmid#207328PurposePiggyBac vector backbone encoding doxycycline-inducible expression of membrane-localized Akt1 (without pleckstrin homology domain)DepositorInsertrac protein kinase-alpha (AKT1 Human)
Tagsmyristoylation tag - BFPExpressionBacterialMutationrange: 129 - 480PromoterTet Response ElementAvailable SinceNov. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
NL4-3 mCherry Luciferase
Plasmid#44965PurposeHIV dual reporter vector expressing mCh & Luc to simultaneously measure the # of cells containing reactivated latent provirus and the overall strength of viral transcriptional response in these cells.DepositorInsertmCherry, Luciferase, IRES
UseLentiviralTagsLuciferase, IRES and mCherry with D212GMutationS34C mutation in NefAvailable SinceOct. 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-pAceR-Kv2.1PR
Plasmid#195534PurposeCre-dependent red fluorescent, positive response-polarity voltage indicator; soma-targetedDepositorInsertpAceR-Kv2.1 proximal restriction sequence
UseAAV and Cre/LoxExpressionMammalianMutationVARNAM 78E, 81D, 92N; SI linkerPromoterCAGAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTN4
Plasmid#174212PurposeDonor plasmid for introducing Peft-3::AtTIR1(F79G)::mRuby at the ttTi5605 locusDepositorAvailable SinceDec. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEvol-pAcFRS.2.t1
Plasmid#73544PurposetRNA synthetase/tRNA pair for the in vivo incorporation of several non-standard amino acids, into proteins in E coli in response to the amber codon, TAGDepositorInsertspAcFRS.2.t1
pAcFRS.2.t1
ExpressionBacterialAvailable SinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynap.(mem).iGlucoSnFR2.mRuby3
Plasmid#244097PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.hSynapFLEX.(cyto).iGlucoSnFR2.mRuby3
Plasmid#244099PurposeCytosolic expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsmRuby3Available SinceSept. 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mem).iGlucoSnFR2.mRuby3
Plasmid#244075PurposePlasma membrane targeted expression of green glucose sensor with non-responsive mRuby3DepositorInsertiGlucoSnFR2.mRuby3
UseAAVTagsIgG kappa leader and mRuby3Available SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only