We narrowed to 27,248 results for: GFP
-
Plasmid#172001PurposeExpression for LIBRON constructsDepositorInsertFKBP DD (L106P)-UbK0G75C
UseRetroviralTagssfGFPMutationchange all lysin residues of ubiquitin to Arg, G7…Available SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
SLF045: AAV-hSyn-eTsChR-GFP
Plasmid#112280PurposeAAV based broad expression of eTsChR in neuronsDepositorInserteTsChR
UseAAVTagsGFPExpressionMammalianPromoterhSynAvailable SinceMay 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-donor_opt(R2Tg)-GFP(intron)
Plasmid#223252PurposeMammalian expression of the optimized R2Tg RNA donorDepositorInsertR2Tg donor_opt
ExpressionMammalianAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-Duet1_6xHis-TEV-eGFP-P62
Plasmid#190929PurposePlasmid for the expression and purification of GFP labelled p62. Internal reference: SMC390DepositorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
P-Ef1a-EGFP-T2A-RPL22-1xFlag
Plasmid#170323PurposeExpresses FLAG and EGFP tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSJ1256 (pFA6-link-yGFP1-10-CaURA3MX)
Plasmid#86419PurposeC-terminal PCR tagging module for yeast codon optimized split GFP1-10DepositorInsertGFP1-10
ExpressionYeastAvailable SinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miniGFP1-P2A-FusionRed
Plasmid#188732PurposeExpress miniGFP1 and FusionRed in mammalian cellsDepositorInsertminiGFP1
UseAAVTagsFusionRedExpressionMammalianPromoterCAGAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSFV_eGFP-P2A-luc2pre (3'UTR)_RLEloop
Plasmid#240255PurposeAttenuated PROTEUS vector with eGFP-LUC transgene. Package VLVs with an envelope-expressing vector such as pCMV-VSV-G, or a transgene-responsive VSV-G expression vector.DepositorInsertEGFP-P2A-firefly luciferase
ExpressionMammalianPromoterSFV subgenomic promoterAvailable SinceFeb. 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-Cas9C-P2A-turboGFP
Plasmid#80942PurposeExpresses Cas9C in mammalian cells; co-expresses turboGFP.DepositorInsertCas9C
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 T21R-vhhGFP4-T2A-mCherry
Plasmid#225587PurposeMammalian expression vector for TRIM21 RING-vhhGFP4 anti-GFP degrader with a self-cleaving T2A-mCherry fluorescent expression reporterDepositorInsertT21R-vhhGFP4-T2A-mCherry
TagsmCherryExpressionMammalianPromoterCMVAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
RhoA sensor (LSS-SGFP2-mCherry)
Plasmid#112948PurposeRhoA FRET biosensorDepositorInsertRhoa sensor
TagsLSS-SGFP2 and mCherryExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc[Chronos-GFP]
Plasmid#62722PurposeAAV-mediated expression of Chronos-GFP under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertChronos-GFP
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsin promoterAvailable SinceApril 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
MscL(G22S)-c-term-cpGFP-ERexp
Plasmid#195346PurposeControl plasmid for the MscL tension biosensorDepositorInsertMscL(G22S)-c-term-cpGFP-ERexp
UseLentiviralExpressionMammalianPromoterCMVd2Available SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHRm-NLS-dCas9-GFP11x7-NLS
Plasmid#70224PurposeExpresses NLS-dCas9-GFP11x7-NLS in mammalian cellsDepositorInsertNLS-dCas9-GFP11x7-NLS
TagsGFP11x7ExpressionMammalianAvailable SinceMarch 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
qTAG-AAVS1-PGK-Puro-moxGFP
Plasmid#227275PurposeAAVS1 targeting donor for the insertion of Puro and a medium strength PGK expressing moxGFP. To be co-transfected with sgRNA plasmid px330-AAVS1 (Addgene #227272)DepositorInsertAAVS1 Homology Arms flanking a 2A-Puro-PGK-moxGFP cassette (AAVS1 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNL4-3 envFS eGFP Δvpu/env
Plasmid#101345PurposeDeletion from NL4-3 nt 6054-7489 encompassing all of vpu and env until before the RREDepositorInsertNL4-3
UseLentiviralMutationdelta vpu/EnvAvailable SinceMarch 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBMN-FKBP DD(L106P)-UbK0G75S-sfGFP
Plasmid#170157PurposeExpression for LIBRON constructsDepositorInsertFKBP DD (L106P)-UbK0G75S
UseRetroviralTagssfGFPMutationchange all lysin residues of ubiquitin to Arg, G7…Available SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEG BacMam N term His8 eGFP 3C
Plasmid#160684PurposeVector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target proteinDepositorTypeEmpty backboneTagsHis8 eGFP 3CExpressionMammalianPromoterCMVAvailable SinceDec. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFPN1-human Dynamin 1aa K44A
Plasmid#22197DepositorInserthuman Dynamin 1aa K44A (DNM1 Human)
TagsGFPExpressionBacterial and MammalianMutationK44AAvailable SinceNov. 2, 2009AvailabilityAcademic Institutions and Nonprofits only -
RhoA sensor (LSS-SGFP2-Scarlet-I)
Plasmid#112947PurposeRhoA FRET biosensorDepositorInsertRhoA sensor
TagsLSS-SGFP2 and mScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-X1-Neo-GFP-FAM134B-LIRmut
Plasmid#109027Purposestable lentiviral expression of cDNADepositorInsertFAM134B-LIRmut (RETREG1 Human)
UseLentiviralTagseGFPExpressionMammalianMutationDDFELL to DDAEAL aa 453-458 to interrupt FAM134B …PromoterEIF-1a promoterAvailable SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
PiggyBac EF1a-eGFP-Puro U6 CLCN3 g2
Plasmid#170829PurposePiggyBac Cas13d sgRNA plasmid for CLCN3 knockdownDepositorInsertCas13d CLCN3 gRNA2
UsePiggybac transposonExpressionMammalianPromoterU6Available SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-FAS-EGFP-WPRE-pA
Plasmid#37091PurposeExpresses EGFP in cells lacking Cre (Cre-Off, flanked by alternative lox FAS sites)DepositorInsertd1eGFP
UseAAV and Cre/Lox; Cre-offPromoterEF1aAvailable SinceJuly 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLenti-C-STAT1-mGFP-P2A-Puro
Plasmid#199345Purposeexpress murine STAT1 protein fused with mGFPDepositorInsertsignal transducer and activator of transcription 1 (Stat1 Mouse)
UseLentiviralTagsmGFPExpressionMammalianPromoterCMVAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK1340-LV-DUAL-dGFP-NanoLuc-Puro
Plasmid#223160PurposeExpression of destabilized GFP (dGFP) and NanoLuc for shortened in vivo half-lifeDepositorInsertdGFP-P2A-NanoLuc
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
tetO-FUW-eGFP-RHOA-Q63L
Plasmid#73081PurposeLentiviral transfer vector for tet-inducible expression of EGFP tagged human RHOA-Q63LDepositorInsertRHOA-Q63L (RHOA Human)
UseLentiviralTagseGFPExpressionMammalianMutationQ63L Constitutively activeAvailable SinceFeb. 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-S149A
Plasmid#136004PurposeDOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO-EGFP-G3BP1-DeltaRBP
Plasmid#136005PurposeDOX-inducible G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex SystemDepositorInsertG3BP1 (G3BP1 Human)
TagsEGFPExpressionMammalianMutationC-term of G3BP1 Deleted for Delta RBPAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CAG-ADAR2-sesRNA-GFP-W3SL
Plasmid#192069PurposeExpression of ADAR2, sesRNA in mammalian cells, with tTA2 as efRNA and ADAR2 overexpression.DepositorInsertsesRNA for mouse Ctip2
UseAAVExpressionMammalianPromoterCbhAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-flex-GFP-4x6T
Plasmid#196418PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertGFP
UseAAV and Cre/Lox; Astrocyte-selectiveExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAG-BFP-sesRNA-GFP-WPRE-pA
Plasmid#192063PurposeExpression of BFP, sesRNA in mammalian cells, with GFP as efRNA.DepositorInsertsesRNA for tdTom
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
TfR-sfGFP-myc tag-SpyCatcher003
Plasmid#133451PurposeExpresses SpyCatcher003 for display at the cell surface of mammalian cells, with superfolder GFP for visualization and myc tag for antibody detectionDepositorInsertTfR-sfGFP-myc tag-SpyCatcher003
TagsGSSGS and myc tagExpressionMammalianMutationContains C20 and A23 mutations that improve plasm…PromoterCMVAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-VPR-eGFP
Plasmid#241307Purpose3rd generation lenti vector encoding dCas9 (s. Pyogenes) fused with the VP64-p65-Rta(VPR) and a 2A GFP fluorescence markerDepositorInserteGFP
UseLentiviralAvailable SinceNov. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEM255 - sgRNA mosTI Pmlc-2_GFP
Plasmid#159835PurposeSingle copy or array insertion by MosTI using split Pmlc-2 GFP selectionDepositorInsertsgRNA mosTI Pmlc-2_GFP
ExpressionWormMutationNot applicableAvailable SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
5'UTR CGG 99x FMR1-EGFP
Plasmid#63091PurposeContains expanded CGG repeats (99 repeats) within the 5'UTR of FMR1 as found in the Fragile X Tremor Ataxia Syndrome (FXTAS). These repeats are in frame with EGFP.DepositorInsertexpanded CGG repeats (99 repeats) within the 5'UTR of FMR1 (FMR1 Human)
TagsEGFPExpressionMammalianPromoterCMVAvailable SinceApril 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV-human Erbb2-IRES-GFP
Plasmid#91888PurposeRetroviral expression of human Erbb2DepositorAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-Jaws-GFP-ER2
Plasmid#65016PurposeAAV-mediated expression of Jaws-ER2 under the human synapsin promoterDepositorInsertJaws-GFP-ER2
UseAAVTagsER2 and GFPExpressionMammalianMutationK200R W214FPromoterhuman synapsinAvailable SinceJuly 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-EGFP-WPRE
Plasmid#51504PurposeCan be used to generate AAV virus that will express EGFP in the presence of Cre in neurons from the synapsin promoterDepositorInsertEGFP
UseAAVPromoterphSyn1Available SinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
pRS416-yZ3EV-Z3pr-yEGFP (RB3579)
Plasmid#69100PurposeURA+ yeast shuttle vector containing yZ3EV TF cassette and a Z3pr driving expression of yEGFPDepositorInsertsyZ3EV cassette
Z3 promoter
yEGFP
ExpressionYeastAvailable SinceSept. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP-AsLOV2-NES27 (pDN158)
Plasmid#72659PurposeConstitutively nuclear variant of a very strong, photocaged NES (AsLOV2-NES 27) for blocking endogenous, CRM-1-dependent nuclear exportDepositorInsertH2B-GFP-AsLOV2-NES27
ExpressionMammalianPromoterCMVAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
CMV:AsCpf1-2A-GFP-U6-sgRNA-cloning vector
Plasmid#194715PurposeBicistronic vector expressing CMV promoter driven AsCpf1, and U6 promoter driven guide RNA that can be cloned with BbsI sitesDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-gRNA-EF1a-EGFP-CAAX
Plasmid#167936PurposegRNA entry vectorDepositorInsertU6-gRNA backbone
UseLentiviralPromoterU6Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-SARS-CoV-2-S-RBD-sfGFP
Plasmid#141184PurposeMammalian expression plasmid for RBD of SARS-CoV-2 protein S (spike) fused with sfGFPDepositorHas ServiceCloning Grade DNAInsertS surface glycoprotein [ Severe acute respiratory syndrome coronavirus 2 ] (S SARS coronavirus 2)
TagsSignal peptide from influenza HA and Superfolder …ExpressionMammalianPromoterCMVAvailable SinceApril 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-EF1a-F0ATPMLS-mCherry-GFP1-10
Plasmid#211466PurposeLentivirus backbone expressing mCherry and GFP1-10 fusion protein with a mitochondrial localization signalDepositorInsertmito-mCherry-GFP1-10
UseLentiviralExpressionMammalianPromoterEF-1aAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/cmGAD67 GFP WPRE SV40pA
Plasmid#245935PurposeGABAergic neuron-specific cmGAD67 promoterDepositorInsertMouse GAD67 promoter, Region ii to Etss (Transcriptional Start Site in Exon1)
UseAAVTagsGFPAvailable SinceDec. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL-U6-sgRNA-SFFV-Puro-P2A-EGFP
Plasmid#175037PurposeLentiviral delivery of sgRNA. Expresses PuroR and eGFP from SFFV promoter.DepositorInsertSp sgRNA scaffold
UseLentiviralPromoterU6Available SinceSept. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-GABARAP-GFP
Plasmid#123111PurposeExpresses 3xFLAG-GABARAP-EGFP in mammalian cells, for monitoring ATG4 activity towards GABARAPDepositorInsertGamma-aminobutyric acid receptor-associated protein (GABARAP Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDEST-CMV 3xFLAG-LC3C-GFP
Plasmid#123110PurposeExpresses 3xFLAG-LC3C-EGFP in mammalian cells, for monitoring ATG4 activity towards LC3CDepositorInsertMicrotubule-associated proteins 1A/1B light chain 3C (MAP1LC3C Human)
Tags3xFLAG and EGFPExpressionMammalianPromoterCMVAvailable SinceMay 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
YY225: pAAV_TRE::GFP- GEMINI(A)-P1N4
Plasmid#228888PurposeAAV plasmid expressing the destabilized GFP-GEMINI(A) under the control of a doxycycline-inducible promotor.DepositorInsertGFP-GEMINI(A)
UseAAVTagsgfpPromoterTREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only