We narrowed to 1,494 results for: U6 promoter
-
Plasmid#184403PurposepX459 (sgRNA and Cas9 expressing plasmid, RRID:Addgene_62988) with targeting sequence specific to AAVS1; targeting sequence is: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1-specific sgRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-MCS
Plasmid#185594PurposeControl lentivector that can be used to express inserts from the PGK promoter and/or shRNA cassettes from U6.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
hROSA26 CRISPR-pX330
Plasmid#105927PurposehROSA26 targeting CRISPR plasmidDepositorInserthROSA26 gRNA
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C6
Plasmid#160457PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C6
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C5
Plasmid#160456PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C5
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C4
Plasmid#160455PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C4
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCY_gRNA_hPAX7-Pro_C3
Plasmid#160454PurposesgRNA targeting human PAX7 promoterDepositorInsertgRNA_hPAX7-Promoter_C3
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pU6-BoxB-petracrRNA
Plasmid#207625PurposeExpresses BoxB-petracrRNA in mammalian cells (with a human-U6 promoter)DepositorInsertBoxB-petracrRNA
UseSynthetic BiologyPromoterhU6Available SinceFeb. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-GG-OMKSL-PGK-Puro
Plasmid#102894PurposePiggyBac transposon system construct with 10 concatenated U6 promoter driven transcriptional cassettes targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters. Contains PGK-puro selection cassette.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OMKSL-PP
Plasmid#102899PurposeEBNA episome plasmid for U6 promoter-driven expression of 10 gRNAs targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters. Includes PGK-puro selection cassette.DepositorUseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinFL
Plasmid#187271PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF3-sh3
Plasmid#69044Purpose3rd generation lentiviral vector expressing IKZF3 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF3-sh2
Plasmid#69043Purpose3rd generation lentiviral vector expressing IKZF3 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBS31-cCARLIN
Plasmid#160928PurposeContains 10 constitutively expressed guide RNAs and CAG-GFP-CARLIN array sequence for DNA barcoding (when used in combination with Cas9)DepositorInsertCARLIN gRNAs and CAG-GFP-CARLIN array
UseMouse TargetingExpressionMammalianPromoterU6 promoter for gRNAs; CAG promoter for GFPAvailable SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcU6_3 MS2 sgRNA
Plasmid#92394PurposeChick-specific U6 sgRNA expression mini-vector, harbouring chick U6_3 pol III promoter, with tracrRNA scaffold containing stem loops allowing binding of bacteriophage MS2 coat protein MCPDepositorInsertchick U6.3 promoter and gRNA cloning cassette including MS2 stem loops
UseCRISPRExpressionMammalianPromoterchick U6.3Available SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh3
Plasmid#69042PurposeLentiviral expression of IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
sgTrack-BFP
Plasmid#164273PurposeEmpty sgRNA expression vector with co-expression of BFP reporterDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EFSAvailable SinceFeb. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T1-pGK-Pur
Plasmid#107382PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
LLP773_pLenti-6xHRBKET-sgRNA
Plasmid#211766PurposeMultiplexed gRNA plasmid targeting six different gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1), with mCherry selectionDepositorInsertgRNAs against six different human gene promoters (PACC1-2, EPCAM-2, B2M-4, KL-3, RBM3-1, HINT1-1)
UseLentiviralPromoterpCMV and U6Available SinceDec. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-RFP-IKZF1-sh2
Plasmid#69041Purpose3rd generation lentiviral vector expressing IKZF1 shRNADepositorAvailable SinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLL5.0-Anillin shRNA
Plasmid#187270PurposeLentiviral expression of shRNA targeting AnillinDepositorAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb2
Plasmid#162794PurposeCcnb2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
SaLgCP
Plasmid#164562PurposePuroDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsFlag-NLS-SaCas9-P2A-PuroRExpressionMammalianPromoterU6 promoter for crRNA expression and EFS promoter…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-GFP-AnillinFL
Plasmid#187272PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full lengthDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsEGFPPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCcnb1
Plasmid#162793PurposeCcnb1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBirc5
Plasmid#160949PurposeBirc5 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-AnillinA740D, E758K
Plasmid#187273PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758KDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationAnillin A740D, E758KPromoterU6, CMVAvailable SinceSept. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shEsco2
Plasmid#160957PurposeEsco2 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shBub1
Plasmid#160948PurposeBub1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMKO.1-shCdk1
Plasmid#160953PurposeCdk1 shRNA in pMKO.1 retroviral vectorDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
c-JUN KO in LentiCRISPRv2GFP
Plasmid#254390PurposeExpress sgRNA targeting human c-JUNDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pTJK689 (EPOR KO in LentiCRISPRv2GFP)
Plasmid#254393PurposeExpress sgRNA targeting human EPORDepositorAvailable SinceApril 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
px-458-sgRNA-IF1
Plasmid#206923PurposePlasmid expressing Cas9, GFP and guides to human IF1 to generate IF1-KO mammalian cell linesDepositorAvailable SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pX458-ARHGEF7/B-Pix
Plasmid#241368PurposeMammalian expression of SpCas9 and gRNA targeting ARHGEF7 (β-Pix)DepositorAvailable SinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only