user-defined upper limit for the number of target sequences returned
Alignment
region of similarity between target and query sequences
E-value
a BLAST statistic representing the significance of an alignment, values close to zero
indicate high sequence similarity with low probability of the similarity occurring by chance
Identities
the number of exact nucleotide or amino acid matches over the alignment, expressed as a fraction
and a percentage
Query Coverage
the length of the query sequence that matches the target sequence in the
alignment
Bit Score
a BLAST statistic measuring the quality of an alignment, higher values indicate a
more significant match
Span
the length of the alignment, including gaps
About Search by Sequence
Search by Sequence performs a nucleotide-nucleotide or protein-translated nucleotide BLAST search against
Addgene’s plasmid sequence database.
BLAST returns plasmids with similarity to the query sequence.
Results are sorted by E-value, a statistic from BLAST that describes the significance of a match.
Lower values are considered better matches.
FASTA headers and numbers at the beginning of each line will be removed.
The query should only contain DNA characters.
Tips for Success
Enter a distinct sequence that is an important, differentiating feature. For example, the coding region of
a gene, instead of the plasmid origin of replication.
Inspect the percent identity, query coverage, and alignment details to determine if a result match is satisfactory.
Visit the corresponding plasmid webpage to view additional details about a matching plasmid.
If no results are returned:
Try a different isoform or region of the desired sequence.
Choose a different BLAST database. Try the general “All Addgene Plasmids” (default selection),
instead of a specific database, such as “Plant Expression Plasmids”
Try selecting a different BLAST algorithm:
megablast: Designed for comparing sequences within the same, or closely related, species.
Default selection.
blastn: Designed for comparing sequences from different species. May return additional results,
if exact species match is not required.
blastn-short: Optimized for searching with shorter sequences (<= 30 nucleotides)
but can still be effective with slightly larger sequences.
tblastn: Designed for comparing protein sequences against a translated nucleotide sequence database.
Helpful for finding plasmids with codon-optimized sequences.
tblastn-fast: A faster version of tblastn that may return results more quickly, but is less sensitive
There may not be a match in our database.
You can adjust the Max Results setting on the results page from 25 to 500. If many sequences share the same top E-value,
only a truncated set of equally high-scoring matches will be shown. Set the Max Results to 500 to see more matches.
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser.
Learn more
Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected].
Learn more
A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:TH1477 chimera) and its U6-driven sgRNA.
A single vector mammalian expression system containing a CAG promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD9:LMG18311 chimera) and its U6-driven sgRNA.
Backbone plasmid for generating CRISPR arrays for composite array utilized by SpCas9 and FnCas12a using CRATES. Contains a GFP-dropout cassette and two direct repeats.
Expression of a catalytically inactive, human codon-optimized Cas9 under the control of Murine Stem Cell retroVirus LTR promoter for mammalian gene knockdown
All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.
All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS106a sequence ATACGGTCAGGGTAGCGCCC in yeast chromosome 1.
Expresses the fusion gene CAS9-HA-2xNLS-GFP in the pTREX-n backbone. This vector is used for cloning a specific sgRNA by BamHI, to be co-expressed with Cas9 for genome editing in Trypanosoma cruzi.
All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.