233,450 results
-
Plasmid#199723PurposeExpresses betalain biosynthesis genes under CaMV 35S promoterDepositorInsert35S-RUBY
ExpressionPlantAvailable SinceApril 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-VP16-GWY/pAM
Plasmid#201234PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-VP16-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GAL4BD-GWY/pAM
Plasmid#201233PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GAL4BD-GWY
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-GAL4BD/pAM
Plasmid#201231PurposeUsed to produce and express in planta N-terminal fusion proteins with the GAL4 BDDepositorInsert35S-GWY-GAL4BD
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
35S-GWY-VP16/pAM
Plasmid#201232PurposeUsed to produce and express in planta C-terminal fusion proteins with the VP16 activation domainDepositorInsert35S-GWY-VP16
ExpressionPlantPromoterCaMV 35SAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVdual-CMV-eGFP
Plasmid#230931PurposepAAVdual plasmid is used to package AAV-CMV-eGFP viruses with the AAVdual system, which integrates the mini-pHelper-1.0 (providing E2A, E4orf6, and VA RNA) with an AAV expression cassette containing eGFP driven by the CMV promoter.DepositorInserteGFP
UseAAVPromoterCMVAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6c
Plasmid#207853PurposeMammalian expression of PE6c prime editorDepositorInsertPE6c
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationTf1rt(P70T, G72V, S87G, M102I, K106R, K118R, I128…Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Blast
Plasmid#83480PurposeMammalian expression of Cas9 and sgRNA scaffoldDepositorInsertBlasticidin S deaminase
UseCRISPR and LentiviralExpressionMammalianMutationReplaced puromycin N-acetyltransferase on the ori…PromoterEF-1αAvailable SinceNov. 10, 2016AvailabilityAcademic Institutions and Nonprofits only -
PPRE X3-TK-luc
Plasmid#1015PurposePPAR reporter. 3xDR1 sites upstream of a luciferase reporter.DepositorInsertPPRE
UseLuciferaseExpressionMammalianAvailable SinceNov. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
PPRE X3-TK-luc
Plasmid#1015PurposePPAR reporter. 3xDR1 sites upstream of a luciferase reporter.DepositorInsertPPRE
UseLuciferaseExpressionMammalianAvailable SinceNov. 3, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV R-CEPIA1er
Plasmid#58216PurposeRed fluorescent indicator for calcium signaling in the endoplasmic reticulumDepositorInsertR-CEPIA1er
TagsmycExpressionMammalianMutationR-GECO1 E300D M305L D329N F332I E336D N346K F361W…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV R-CEPIA1er
Plasmid#58216PurposeRed fluorescent indicator for calcium signaling in the endoplasmic reticulumDepositorInsertR-CEPIA1er
TagsmycExpressionMammalianMutationR-GECO1 E300D M305L D329N F332I E336D N346K F361W…PromoterCMVAvailable SinceJuly 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
TFORF1106
Plasmid#143762PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MCS2
Plasmid#46954PurposeCloning plasmid for the generation of Knock-In in human cells using rAAV.DepositorTypeEmpty backboneUseAAVAvailable SinceSept. 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.(mito).cpSFGFP.HaloTag
Plasmid#214925PurposeExpresses mitochondrially targeted non-responsive controlDepositorInsert(mito).cpSFGFP.HaloTag
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP
Plasmid#37825PurposeAAV-mediated expression of GFP under the CAG promoterDepositorHas ServiceAAV CAP-B10, AAV CAP-B22, AAV MaCPNS1, AAV MaCPNS2, AAV PHP.eB, AAV Retrograde, AAV Retrograde trial size, AAV1, AAV1 trial size, AAV11, AAV11 trial size, AAV2, AAV2 trial size, AAV5, AAV5 trial size, AAV6, AAV6 trial size, AAV8, AAV8 trial size, AAV9, AAV9 trial size, and AAV9-X1.1InsertGFP
UseAAV; Adeno-associated virusExpressionMammalianMutationN/APromoterCAGAvailable SinceAug. 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
Human sgRNA library Brunello in lentiGuide-Puro
Pooled Library#73178PurposeHuman sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000 non-targeting controlsDepositorHas ServiceLentiviral PrepExpressionMammalianUseCRISPR and LentiviralAvailable SinceFeb. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV1)
Viral Prep#59462-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV1)
Viral Prep#50465-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH
Plasmid Kit#1000000163PurposeA collection of 20 plasmids encoding alpha, beta, or gamma subunits of the heterotrimeric G protein complex for detection of heterotrimer dissociation. GPCRDepositorAvailable SinceJuly 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
LsgRNA-MS2
Plasmid#235597PurposesgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2. The cloning site is BsmbI.DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-miRFP670nano3
Plasmid#184664PurposeMonomeric near-infrared fluorescent protein miRFP670nano3 in mammalian plasmidDepositorInsertmiRFP670nano3
TagsHisExpressionMammalianPromoterCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV9)
Viral Prep#59171-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFR WT
Plasmid#11011PurposeRetroviral construct for expressing human EGFR in human cellsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
EGFR WT
Plasmid#11011PurposeRetroviral construct for expressing human EGFR in human cellsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA
Plasmid#61591PurposeA single vector AAV-Cas9 system containing Cas9 from Staphylococcus aureus (SaCas9) and its sgRNA.DepositorInsertshSaCas9
Chimeric guide for SaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianAvailable SinceFeb. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCherry
Plasmid#60032PurposeExpresses a fusion of CRY2PHR E490G with mCherryDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
CRY2olig-mCherry
Plasmid#60032PurposeExpresses a fusion of CRY2PHR E490G with mCherryDepositorAvailable SinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pV1524
Plasmid#111431PurposeCaCas9/gRNA Solo entry plasmid for cloning guides - contains stuffer with BsmBI sites - inserts at Neut5L - Recyclable for serial mutagenesis (Mal2-FLP)DepositorInsertCaCas9/sgRNA-BsmBI stuffer
UseCRISPRExpressionYeastAvailable SinceAug. 29, 2018AvailabilityAcademic Institutions and Nonprofits only