173,361 results
-
Plasmid#25890Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection, V5 tag.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorTagsV5ExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only
-
v5 ABE-eVLP
Plasmid#228467PurposeExpresses MMLVgag(C507V)–ABE8e for producing v5 ABE-eVLPsDepositorInsertMMLVgag(C507V)–ABE8e
TagsFLAGExpressionMammalianMutationMMLVgag(C507V)PromoterCMVAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0 (AAV9)
Viral Prep#121922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_ACh3.0 (#121922). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_ACh3.0 plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-mCherry (AAV2)
Viral Prep#50459-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-mCherry (#50459). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-mCherry plasmid DNA. hSyn-driven, Cre-dependent mCherry-expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUltra
Plasmid#24129Purpose3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interestDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-PR rep/cap
Plasmid#197565Purposeencodes AAV-PR capsid that transduces pericytes and smooth muscle cells in mice after systemic deliveryDepositorInsertsAAV Rep genes
AAV9 VP1 Cap gene with PR insert
UseAAVMutationcontains 7mer insert PRPPSTH between amino acids …Available SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7s-WPRE (AAV1)
Viral Prep#104487-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7s-WPRE (#104487). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven GCaMP7s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-Opto-zFGFR1a
Plasmid#232639PurposeZebrafish FGFR1a receptor kinase domain fused to VfLOVDepositorInsertzFGFR1a kinase domain + VfLOV domain
Available SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K63
Plasmid#17606PurposeMammalian expression of HA tagged ubiquitin with K63 only, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK63 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pBOB-EF1-FastFUCCI-Puro
Plasmid#86849Purpose3rd generation lentiviral vector encoding FUCCI reporters for cell cycle analysis and puro for selectionDepositorInsertsmKO2-hCDT1(30-120)
mAG-hGEM(1-110)
pac (puromycin N-acetyl-transferase)
UseLentiviralExpressionMammalianPromoterEF1 and PGKAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1-FLAG-IRES-eGFP
Plasmid#234619PurposeMammalian expression of full-length hnRNPA1 with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationC-terminal FLAG tag, co-expressing with eGFP via …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K48
Plasmid#17605PurposeMammalian expression of HA tagged ubiquitin with only K48, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK48 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pV238-vPE
Plasmid#225258PurposeMammalian expression of vPEDepositorInsertvPE
UseCRISPRExpressionMammalianMutationR221K K848A H982A N1317RPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC107_pLenti_TetON_sfGFP_INT
Plasmid#242109PurposeTet- or Dox-inducible expression of sfGFP fused to INT (human PARP4 fragment)DepositorInsertPARP4 fragment
UseLentiviralTagssfGFPMutationPARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTn Donor
Plasmid#236211PurposeArabinose-inducible Tn5 InducTn-seq plasmidDepositorInsertNone
ExpressionBacterialAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-KO
Plasmid#17603PurposeMammalian expression of HA tagged ubiquitin carrying zero lysines (K0)DepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationKO: all lysines mutated to argininesAvailable SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pKC148_Lenti_Tetoff_MVP_EF1a_tagRFP
Plasmid#250949PurposeA lentiviral vector express MVP gene under a Tetoff system. Contains tagRFP as selection marker.DepositorAvailable SinceJan. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hGal3
Plasmid#73080PurposeExpression in mammalian cellsDepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1187 VSVGmut
Plasmid#201913PurposeExpresses a VSV-G variant (K47Q R354A) defective for LDL-R receptor binding (CAG promoter)DepositorInsertVSV-G (K47Q, R354A)
ExpressionMammalianMutationK47Q, R354APromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (AAV9)
Viral Prep#105545-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (#105545). In addition to the viral particles, you will also receive purified pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 plasmid DNA. CMV-driven EGFP-Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHITagsEGFPAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV9)
Viral Prep#37825-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-EcoEnv
Plasmid#15802DepositorInsertMLV env (ecotropic)
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (AAV1)
Viral Prep#171027-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-fDIO-ChrimsonR-tdTomato (#171027). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO-ChrimsonR-tdTomato plasmid DNA. Flp-dependent, Ef1a-driven expression of ChrimsonR-tdTomato fusion for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagstdTomatoAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3/mStayGold(c4)=UtrCH
Plasmid#212020PurposeFor filamentous actin labeling. Alternatively, the UtrCH gene can be replaced with a target gene for N-terminal tagging with mStayGold via a c4 adaptor and a linker [(GGGGS)3] (denoted as ‘=’).DepositorInsertUtrCH
TagsmStayGold(c4)ExpressionMammalianPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNatB (pACYCduet-naa20-naa25)
Plasmid#53613PurposeAllows expression of the fission yeast NatB complex - chloramphenicol markerDepositorAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
CMV-hRad51
Plasmid#125570PurposeExpresses the Rad51 protein in mammalian cells under CMV promoterDepositorAvailable SinceMay 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV1)
Viral Prep#20298-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE7-P2A-GFP
Plasmid#222996PurposeMammalian expression of SpCas9 PE7 prime editor with P2A-EGFP markerDepositorInsertPE7-P2A-EGFP
TagsP2A-EGFP, SV40 bpNLS, and c-Myc NLSExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hsyn-GRAB_DA2m (AAV9)
Viral Prep#140553-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hsyn-GRAB_DA2m (#140553). In addition to the viral particles, you will also receive purified pAAV-hsyn-GRAB_DA2m plasmid DNA. Synapsin-driven expression of 2nd generation medium affinity dopamine sensor GRAB_rDA2m. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceAug. 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV5)
Viral Prep#28306-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV Retrograde)
Viral Prep#50465-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. Synapsin-driven EGFP-expression control. These AAV preparations are suitable purity for injection into animals. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons.DepositorPromoterSynTagsEGFPAvailable SinceOct. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral Prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-GFAP-hM3D(Gq)-mCherry (AAV5)
Viral Prep#50478-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-GFAP-hM3D(Gq)-mCherry (#50478). In addition to the viral particles, you will also receive purified pAAV-GFAP-hM3D(Gq)-mCherry plasmid DNA. GFAP-driven hM4D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterGFAPTagsmCherryAvailable SinceJune 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZT-C13-L1
Plasmid#62196PurposeChr.13/CLYBL TALEN expression vectorDepositorInsertLeft CLYBL TALEN
UseTALENPromoterCMVAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pZT-C13-R1
Plasmid#62197PurposeChr.13/CLYBL TALEN expression vectorDepositorInsertRight CLYBL TALEN
UseTALENPromoterCMVAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMK381 (AAVS1 CMV-OsTIR1F74G)
Plasmid#140536PurposeAAVS1 CMV-OsTIR1(F74G)DepositorInsertCMV-OsTIR1(F74G)
ExpressionMammalianAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-Venus-Akaluc (neo)
Plasmid#124701PurposeAka-Luciferase reporterDepositorInsertVenus-Akaluciferase
UseLentiviralPromoterhPGKAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psPAX2-D64V
Plasmid#63586PurposepsPAX2-D64V is derived from psPAX2 plasmid. It is a packaging plasmid for making Integrase deficient lentiviral vectors since has a point mutation in the integrase gene.DepositorInsertPackaging plasmid for integrase deficient lentiviral vectors
UseIntegrase deficient lentiviral packaging vectorAvailable SinceApril 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
TFORF3549
Plasmid#145025PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens. This is the control vector for the collection.DepositorInsertGFP
UseLentiviralExpressionMammalianPromoterEF1aAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
eeBxb1
Plasmid#222339PurposePlasmid for expressing evolved and engineered Bxb1 in the mammalian cellsDepositorInsertCodon-optimized evolved and engineered Bxb1
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceJune 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA blast
Plasmid#104993PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and blasticidin S resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEM4Z-T7-5'UTR-EGFP-3'UTR-A64
Plasmid#203348PurposeTemplate for T7 in vitro transcription of EGFP mRNA flanked by Xenopus beta globin UTRs and 64nt polyA tailDepositorInsertEnhanced Green Fluorescent Protein
UseTemplate for t7-mediated in vitro transcription o…TagsFlanked by 5' and 3' UTRs from Xenopus …PromoterT7Available SinceJune 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-PE6d
Plasmid#207854PurposeMammalian expression of PE6d prime editorDepositorInsertPE6d
TagsSV40 bpNLS and SV40 bpNLS, c-Myc NLSExpressionMammalianMutationM-MLVRTDRNAseHrt(T128N, V223Y, D200C)Available SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT7-7 asyn WT
Plasmid#36046DepositorAvailable SinceJuly 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA hygro
Plasmid#104991PurposeThis 3rd generation lentiviral plasmid expresses a S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from a U6 promoter and hygromycin resistance from an EF-1a promoter.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-HA
Plasmid#128034PurposeMammalian expression vector with N terminal HA tagDepositorTypeEmpty backboneTagsHAExpressionMammalianAvailable SinceAug. 23, 2019AvailabilityAcademic Institutions and Nonprofits only