We narrowed to 7,693 results for: tet on
-
Plasmid#245878PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-TLS-PtALSgRNA
Plasmid#245881PurposeGolden gate entry vector carrying the gRNA for base editing in Poplar hybrid ALS gene along with TLS mobile RNA sequenceDepositorInsertPtALSgRNA
UseCRISPRExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ133B-CsALSgR1.2
Plasmid#245876PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-MS2-RecT-dCas9-BSD
Plasmid#226108PurposeUsing ef-1a promoter, expresses dCas9 and RecT protein that intended to be tethered via MS2 gRNA hairpin to dCas9, and Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCIFR-5
Plasmid#233294PurposeIntegration of msfGFP (or your Module Of Interest) in a random fashion via Tn5 insertion. The antibiotic cassette used for selecting for the integration can be removed in a later stage with pFNC.DepositorInsertmsfGFP
Promoterp14G-BCD2Available SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB-DEST (JDW 1205)
Plasmid#229821PurposeA PiggyBac destination vector compatible with gateway cloning system.DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crBFP_EF1a-BFP
Plasmid#224785PurposeBFP targeting crRNA for RfxCas13d expressed from hU6 promoter and target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-CrEGFP_EF1a-BFP
Plasmid#224786PurposeEGFP targeting crRNA for RfxCas13d expressed from hU6 promoter and non-target BFP protein expressed from EF1a promoterDepositorInsertcrBFP
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6 and hU6-2xTetOAvailable SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
AA440
Plasmid#216036PurposeFragmid fragment: (Cas protein) binds to TRE in absence of doxycyclineDepositorHas ServiceCloning Grade DNAInsertTetR_v1.1
UseCRISPR; FragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYG215
Plasmid#200837PurposeTranscribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.DepositorInsertglmZ (glmZ Escherichia coli str. K-12 substr. MG1655)
UseSynthetic BiologyTagsGFPExpressionBacterialPromoterP-LlacO-1Available SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
DsRed -7e
Plasmid#191765PurposeExpression of DsRed fused to a negatively charged polypeptide. Overall charge on tetramer: -7eDepositorInsertDsRed
TagsN terminal fusion of negatively charged polypetod…ExpressionBacterial and MammalianPromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
CMV+ (mScarlet-I) plasmid with onboard mCitrine cassette
Plasmid#169743PurposeCMV+ circuit plasmid that encodes mScarlet-I to report the circuit output levels. This plasmid also encodes a separate mCitrine expression cassette to monitor plasmid dosage.DepositorInsertmScarlet-I
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_Kctd19-3xHA
Plasmid#173497PurposeExpress Kctd19-3xHA under the mouse Clgn promoter.DepositorInsertPotassium Channel Tetramerization Domain Containing 19 (Kctd19 Mouse)
TagsHAExpressionMammalianAvailable SinceSept. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pClgn1.1_3xFLAG-Kctd19
Plasmid#173498PurposeExpress 3xFLAG-Kctd19 under the mouse Clgn promoter.DepositorInsertPotassium Channel Tetramerization Domain Containing 19 (Kctd19 Mouse)
TagsFLAGExpressionMammalianAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP-uTEV1-SQSfl
Plasmid#171010PurposeHiLITR protease with full-length SQS targeting information (ER)DepositorInsertEGFP-uTEV1-SQS(FL)
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterpTRE-tight (TetOn)Available SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
RA35
Plasmid#141126PurposeExpresses dimeric LacI repressor (LacI-11) under Rhl promoterDepositorInsertsTagsssrA degradation tagExpressionBacterialMutationtruncated/dimeric version of LacI (missing last 1…Promoterengineered rhl promoter (responds to C4-HSL) and …Available SinceJuly 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMT3-RhoGC D380E
Plasmid#100035PurposeThis plasmid is for expression of a rhodopsin/guanylyl cyclase fusion protein mutant with lambda max = 533 nm.DepositorInsertRhoGC D380E
Tags1D4 (TETSQVAPA)ExpressionMammalianMutationD380EPromoterAdenovirus major late promoterAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMT3-RhoGC D380N
Plasmid#100034PurposeThis plasmid is for expression of a rhodopsin/guanylyl cyclase fusion protein mutant with lambda max = 506 nm.DepositorInsertRhoGC D380N
Tags1D4 (TETSQVAPA)ExpressionMammalianMutationD380NPromoterAdenovirus major late promoterAvailable SinceSept. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1[Iq:LacI-T]
Plasmid#60756PurposeContains PIq driving expression LacI-T, the Lactose inducible chimera with the TAN DBD.DepositorInsertLacI-T
UseSynthetic BiologyExpressionBacterialMutationLacI without the tetramerization domain and the T…Available SinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFAB1907
Plasmid#47857PurposeBIOFAB reporter plasmid for measuring BBa_B1006 U10 termination efficiencyDepositorInsertBBa_B1006 U10
UseSynthetic BiologyExpressionBacterialMutationAdded two extra U at the end of Bba_1006 poly-U t…PromoterpLTetO12Available SinceDec. 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFAB801
Plasmid#47846PurposeBIOFAB reporter plasmid for measuring trp_att_L126 termination efficiencyDepositorInserttrp_att_L126 terminator
UseSynthetic BiologyExpressionBacterialMutationLoop mutation in trp TerminatorPromoterpLTetO1Available SinceAug. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
CMV-sgE1TSS-short-3'box
Plasmid#92165PurposesgRNA expression vector for Evx1as RNA tethering assayDepositorInsertEvx1as short isoform
UseCRISPRPromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pSF4 CMV 5TOP intron renilla TRICK CTE polyA
Plasmid#64544Purpose5′ TOP TRICK reporter mRNADepositorInsert12x PP7 stem-loops
Tags24xMS2 stem loops, 5' TOP (5′ terminal oligo…ExpressionMammalianPromoterTetracycline-inducible promoter and 5′ UTR of hum…Available SinceMay 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro backbone
Plasmid#73795Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHPHS232
Plasmid#228356PurposeLanding pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locusDepositorInsertsmTagBFP2
Reverse tetracycline transactivator 3
neo
TagsBlasticidin S deaminase and iCasp9ExpressionMammalianPromoterTRE3GV and gene trapAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pB80-SSPB(micro)-GFP-GCN4-ppKin14VIb(861-1321)
Plasmid#174640PurposeOptogenetic coupling to tetramerized moss kinesin-14 via SSPB(micro) for highly efficient retrograde transportDepositorInsertSSPB(micro)-GFP-GCN4-ppKinVIb(861-1321)
TagsSSPB(micro)-GFPExpressionMammalianMutationSSPB:Arg73Gln; EGFP: Met1Del; ppKin14VIb(aa861-13…PromoterChicken beta-actinAvailable SinceNov. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-FRT-TO-FH-Nsp5
Plasmid#157686Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp5 under control of a tetracycline-inducible promoterDepositorAvailable SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDNA5 TEX264wt-cGFP
Plasmid#220211PurposeMammalian expression of wild type TEX264 fused at C-terminus to GFPDepositorAvailable SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_zeo backbone
Plasmid#61427Purpose3rd generation lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLV_TRET_hNgn2_UBC_Puro
Plasmid#61474Purpose3rd generation lentiviral vector; TetON promoter driving human Ngn2; constitutive expression of Puromycin selection markerDepositorInsertsUseLentiviralAvailable SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
lenti sgRNA(MS2)_puro optimized backbone
Plasmid#73797Purposeoptimized lenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 and EF1AAvailable SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSW002-PpsbA-mNeonGreen
Plasmid#205017PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; mNeonGreen (codon optimized for P. fluorescens)DepositorInsertmNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPpsbAAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
qMaLioffG
Plasmid#212825Purposegreen fluorescent FLIM indicator for endogenous ATP imagingDepositorInsertqMaLioffG
ExpressionMammalianPromoterCMVAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSW003-PpsbA-mNeonGreen
Plasmid#205019PurposeBroad host-range bacterial expression vector with constitutive PsbA promoter; mNeonGreen (codon optimized for P. fluorescens)DepositorInsertmNeonGreen
ExpressionBacterialMutationmNeonGreen is codon optimized for expression in P…PromoterPpsbAAvailable SinceSept. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pB-TAG-NICD
Plasmid#130934PurposePiggyBac vector for DOX-inducible human NICD-IRES-EGFP expression in mammalian cellsDepositorAvailable SinceOct. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJZC34
Plasmid#62331PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2(wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
integrin alpha9 pcDNA1 neo
Plasmid#13585DepositorInsertintegrin alpha 9 (ITGA9 Human)
ExpressionMammalianAvailable SinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1658-dCas9-EGFP
Plasmid#51023PurposeTemplate for NLS-dCas9-NLS-EGFP fusion protein for CRISPR imaging (the recipient vector can be TetON 3G promoter system)DepositorInsertdCas9 fuse to EGFP
UseCRISPR and RetroviralTagsEGFPExpressionMammalianPromoterMSCV LTR promoterAvailable SinceFeb. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCS2-UTX-F-MT2
Plasmid#40619PurposeExpression of enzyme-dead UTX in mammalian cellsDepositorInsertUTX (KDM6A Human)
Tags6xMyc and FlagExpressionMammalianMutationchanged Histidine 1146 and Glutamic Acid 1148 to …PromoterCMVAvailable SinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
Tol2-CAG::Mitbow
Plasmid#158994PurposeMulticolor mitochondrial-restricted labeling with a genome-integrating Tol2 transposon vector (randomly expressing mito-tethered mEYFP, mCherry or mCerulean upon Cre recombination)DepositorInsertMitbow
TagsThe default expressed EBFP2 is fused to H2B; oth…ExpressionMammalianPromoterCAGAvailable SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pINTO-NFH::hSNRNP70
Plasmid#65926PurposeExpression of human SNRNP70 fused to Flag-HA tag (N-terminus)DepositorInsertsmall nuclear ribonucleoprotein 70kDa (U1) (SNRNP70 Human)
TagsFLAG-HAExpressionMammalianMutationTwo silent mutationsPromoterCMV/TO and CMV/TetO2 (T-REx)Available SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
Hygro-Cas9 donor
Plasmid#86883PurposeDonor vector for genomic targeting of a Tetracycline-inducible Cas9 cassette to the human AAVS1/PPP1R12C locus with hygromycin selectionDepositorInserthSpCas9
UseCRISPRTags3xFlag, Nucleoplasmin NLS, and SV40 NLSExpressionMammalianAvailable SinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-mGFAP-Lck-PinkFlamindo
Plasmid#228394PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVPromotermGFAPAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FUW-Sox10
Plasmid#36978DepositorAvailable SinceJuly 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pcDNA4/TO-HRASG12V
Plasmid#216509PurposeExpresses HRAS with a G12V point mutation in human cells under a tetracycline/doxycycline-inducible promoterDepositorAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
hCathepsin S
Plasmid#11251PurposeMammalian expression of human Cathepsin SDepositorAvailable SinceAug. 4, 2006AvailabilityIndustry, Academic Institutions, and Nonprofits