We narrowed to 21,477 results for: SPR
-
Plasmid#195569PurposedLbCas12a-D156R based adenine base editor, ecTadA8e fused to the N terminal of dLbCas12a-D156R with the linker of (GSAGSAAGSGEF)x3DepositorInsertecTadA8e-(GSAGSAAGSGEF)x3-dLbCas12a-D156R
UseCRISPR; Gateway compatible ectada8e-(gsagsaagsgef…Tags5' and 3' NLSExpressionPlantPromoterZmUBI1Available SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pM115: CasRx control presgRNA
Plasmid#166867PurposeU6-driven expression of control (non-targeting) presgRNA compatible with CasRx.DepositorInsertnon-targeting presgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEG302 22aa SunTag NtDRMcd gRNA4 (FWA)
Plasmid#115486PurposeCRISPR-Cas9 SunTag system to target NtDRMcd to the FWA locus with a single guide RNADepositorInsertg4_U6_NOS_NLS_GB1_NLS_linker_DRMcd_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_3xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceApril 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET28b-NmCas9-Flag
Plasmid#109030PurposeWild type Cas9 from Nm8013 cloned into pET28b with a C-terminal Flag tag for protein expressionDepositorInsertCRISPR-associated endonuclease Cas9
TagsFlag TagExpressionBacterialPromoterT7Available SinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
sg2.02 MUC4.1
Plasmid#101152PurposegRNA with two MCP binding sitesDepositorAvailable SinceNov. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3048(gRNA XII-2)
Plasmid#73290PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-tomato SOX2-sgRNA
Plasmid#196190PurposeEditing human SOX2 locusDepositorInsertSOX2 (SOX2 Human)
UseCRISPRAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDonor14-AcHELIX-KanR (CJT96)
Plasmid#181794PurposepDonor for AcHELIX containing 14bp of spacing between the I-AniI site and LE/RE using ShCAST flanking sequence and encoding a kanamycin resistance gene as cargoDepositorInsertKanR, R6K origin of replication
ExpressionBacterialAvailable SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas5
Plasmid#178878PurposeExpression of human codon-optimized Nlacas5 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas5c-bGH polyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas7
Plasmid#178879PurposeExpression of human codon-optimized Nlacas7 with C terminal NLS and HA tagDepositorInsertEF1a-NlaCas7c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSmart-EF1a-Nla-cas8
Plasmid#178880PurposeExpression of human codon-optimized NlaCas8 with N terminal NLS and HA tagDepositorInsertEF1a-NlaCas8c-bGH PolyA
TagsHA and NLSExpressionMammalianPromoterEF1aAvailable SinceJan. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP.Control
Plasmid#128749PurposeExpresses control gRNADepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceOct. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Doc2A-GFP KI
Plasmid#131478PurposeEndogenous tagging of Doc2a: C-terminal (amino acid position: L402)DepositorAvailable SinceSept. 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pORANGE WASF1-GFP KI
Plasmid#131502PurposeEndogenous tagging of WASP1/WAVE1: C-terminal (amino acid position: STOP codon)DepositorAvailable SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK408 (mAID-Nluc Hygro)
Plasmid#121198PurposeC-terminal taggingDepositorInsertmAID-Nluc Hygro
UseCRISPRAvailable SinceMarch 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMK390(Stag-3FLAG-BSD)
Plasmid#121191PurposeC-terminal taggingDepositorInsertStag-3FLAG-BSD
UseCRISPRAvailable SinceFeb. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-CL7_MBP_1xNLS_iGeoCas9(C2)_2xNLS(star)
Plasmid#222991PurposeBacterial expression of iGeoCas9(C2) constructDepositorInsertHis-CL7_MBP_1xNLS_iGeoCas9(C2)_2xNLS(star)
UseCRISPRTagsCL7, His, and MBPExpressionBacterialPromotertacAvailable SinceJuly 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-EF1alpha-VP64-dCas9-p300_Blast
Plasmid#192654Purpose3rd generation lenti vector encoding VP64-dCas9-p300 with 2A Blast resistance markerDepositorInsertVP64-dCas9-p300
UseCRISPR and LentiviralExpressionMammalianMutationD10A; H840A in Cas9PromoterEF1aAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-dAaCas12b-Act3.0
Plasmid#158413PurposeCRISPR-Act3.0 system containing dAaCas12b-VP64 fusion protein, T2A linked MS2-SunTag fusion protein, and ScFv-sfGFP-2xTAD activator.DepositorInsertdAaCas12b-VP64-T2A-MS2-SunTag-rbcS-E9t-ter-ZmUbi-scFv-sfGFP-2xTAD-GB1-NOS-ter
UseCRISPRExpressionPlantAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV_eA3A T31A-dCas9
Plasmid#163537PurposeMammalian CG-to-GC base editingDepositorInserteA3A T31A-dCas9
UseCRISPRExpressionMammalianMutationdCas9 (D10A, H840A)eA3A T31AAvailable SinceDec. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a6
Plasmid#124860PurposeMutagenesis of Slc17a6DepositorInsertSlc17a6 (Slc17a6 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SMVP-Cas9N-U6-gRNA TdL
Plasmid#80938PurposeExpresses Cas9N in mammalian cells; expresses gRNA TdL for Ai9 cleavage.DepositorInsertCas9N
UseAAV, CRISPR, and Synthetic BiologyExpressionMammalianAvailable SinceOct. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEJS2602_AAV-Nme2-ABE8e-i1(V106W)-U6-2xSapI
Plasmid#201684PurposeAll-in-one AAV plasmid expressing Nme2-ABE8e-i1(V106W) and U6 sgRNA cassette. SapI enables cloning new spacers.DepositorInsertNme2-ABE8e-i1 (V106W)
UseAAV and CRISPRExpressionMammalianPromoterU1aAvailable SinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_070
Plasmid#164265PurposeLentiviral vector that enables Cre-mediated sgRNA expression. Also encodes the fluorophore violet-excited GFP (Vex) as a marker of transduction.DepositorInsertsgRNA cassette
UseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterHuman U6Available SinceNov. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBBR1.cas9-NT
Plasmid#197871PurposeConstitutive expression of Cas9 endonuclease, trancRNA and crRNA with a randomly generated spacer sequence (non-targeting)DepositorInsertstrancCRNA
Cas9
crRNA (non-chromosomal (E. coli/S. flexneri)-targeting spacer sequence)
ExpressionBacterialAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-SA-neo-CAGGS-PE2-2A-GFP
Plasmid#180014PurposeTargeting vector for knocking in constitutively expressed PE2-2A-GFP into the human AAVS1 locusDepositorInsertPE2-2A-GFP
UseCRISPR; Human genome engineeringTagsGFPPromoterCAGAvailable SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
p23-NES-PspCas13b-msfGFP-NES-Flag
Plasmid#165071Purposeoverexpression of PspCas13b in human cellsDepositorInsertPspCas13b
UseLentiviralExpressionMammalianAvailable SinceMay 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
ND4 left TALE–G1333 DddAtox C
Plasmid#158092Purposeexpresses the right-side ND4 TALE–DddAtox half in mammalian cellsDepositorInsertSOD2 MTS–3xHA–ND4 left TALE–G1333 DddAtox-C–1xUGI
ExpressionMammalianMutationWTAvailable SinceAug. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUF-AsCpf1-pre-gRNA
Plasmid#137849PurposeAsCpf1 and gRNA expression plasmid for P. falciparum with yDHODH selectable marker.DepositorInsertAsCpf1 and pre-gRNA cassette
UseCRISPRAvailable SinceApril 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_EIF2AK2
Plasmid#106108PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting EIF2AK2DepositorInsertgRNA targeting EIF2AK2 (EIF2AK2 Human)
UseCRISPRAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTMt_NES_TCS(Q’G)_HA-dCas9(N)_P2A-Puro-WPRE
Plasmid#101101PurposeEncodes dCas9(N) fused to transmembrane tetherDepositorInsertTMt-dCas9(N)
UseCRISPR and Synthetic BiologyTagsHA and MycExpressionMammalianAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-PIG-miR-146a
Plasmid#64234PurposeExpresses miR-146a in mammalian cellsDepositorAvailable SinceNov. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
psgRNA (GB0645)
Plasmid#68210PurposeProvides a Short guide RNA which is the combination of the bacterial crRNA and tracrRNA into a single guide transcript; it does not contain any target siteDepositorInsertSgRNA
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only