We narrowed to 11,070 results for: AGA
-
Plasmid#107403PurposeLentiviral expression of Cas9 and gRNA targeting PBRM1DepositorInsertgRNA targeting PBRM1 (PBRM1 Human)
UseLentiviralAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_2
Plasmid#86347PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF9_1
Plasmid#86346PurposeEncodes gRNA for 3' target of human KLF9DepositorInsertgRNA against KLF9 (KLF9 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-32-riot_punisher
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-32-riot_punisher
Plasmid#138987PurposeIVT template for the alpha subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-31-murderous_crow
Plasmid#138986PurposeIVT template for the beta subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRA-31-murderous_crow
Plasmid#138985PurposeIVT template for the alpha subunit of the mouse TCR #31 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-30-picky_sticky
Plasmid#138984PurposeIVT template for the beta subunit of the mouse TCR #30 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pENTR-attB-PUb-GFP
Plasmid#183911PurposeattB-site containing docking plasmid for genomic insertion into attP site, encoding GFP under control of the Aedes aegypti PUb promoterDepositorInsertGFP
PromoterAedes aegypti PUbAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO human ULK1 shRNA 8
Plasmid#27633DepositorInserthuman ULK1 shRNA 8
UseLentiviral and RNAiExpressionMammalianPromoterU6Available SinceMarch 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEHAC1- HA-BirA-Traf6
Plasmid#232585PurposeExpress BirA tagged to the N-terminus of TRAF6.DepositorAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
cASPG1-mRFP
Plasmid#181962PurposeASPG1 protein tagged with mRFP, under control of TBA2 promoterDepositorAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shSOD1
Plasmid#102975PurposeSuppression of SOD1DepositorInsertshSOD1 (SOD1 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
E42_gRunx1_gRNA3_dTet_NGFR
Plasmid#189803PurposeRetroviral delivery of guide RNA against mouse Runx1DepositorInsertgRunx1_gRNA3 (Runx1 Mouse)
UseRetroviralAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE Bsn-GFP KI
Plasmid#139665PurposeEndogenous tagging of Bassoon: C-terminal (amino acid position: F3938)DepositorInsertgRNA and GFP donor
ExpressionMammalianPromoterU6 and CbhAvailable SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCA24N-ligase-NLS-cTF
Plasmid#87746PurposeIPTG-inducible expression of ligase-NLS-cTF fusion for protein purificationDepositorInsertT4 DNA ligase (30 )
Tags6xHis and NLS linker - cTF (chimeric transcriptio…ExpressionBacterialPromoterT5-lacAvailable SinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pW267-lenti-spsgRNA-hsCDH1-sg1-pEF1s-NLS-mScarlet-I-P2A-BlastR
Plasmid#170816PurposeLentiviral vector to co-express a human CDH1 spsgRNA (sg1-Cdh1) with NLS-mScarlet-IDepositorInsertNLS-mScarlet-I-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A6.5 gRNA
Plasmid#90569Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A6.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX335-EN475
Plasmid#86231PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN477.DepositorInsertspCas9-nickase and sgRNA against mouse CTCF STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
CBX3 A5.5 gRNA
Plasmid#90568Purpose3rd generation lentiviral gRNA plasmid targeting human CBX3DepositorInsertCBX3 (Guide Designation A5.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX335-EN477
Plasmid#86232PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse CTCF locus. Use together with pX335-EN475.DepositorInsertspCas9-nickase and sgRNA against mouse CTCF STOP Codon
UseMouse TargetingExpressionMammalianAvailable SinceMay 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GSK3β-#1
Plasmid#32496DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pX330 Human 3' HP1a gRNA
Plasmid#127907PurposeWT Cas9 Vector targeting the 3' end of the human HP1a geneDepositorInsertgRNA for Human 3' HP1a
UseCRISPRAvailable SinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP5
Plasmid#160088PurposeBacterial expression of Tn5-APEX2 fusion protein with linker GSGAGADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH2_3
Plasmid#36389DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
RRM2 E3.3 gRNA
Plasmid#90882Purpose3rd generation lentiviral gRNA plasmid targeting human RRM2DepositorInsertRRM2 (Guide Designation E3.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
Fireworks GFP[PTC-] (AVA2598)
Plasmid#85445PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
Fireworks RFP[PTC-] (AVA2515)
Plasmid#85443PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a beta-globin reporter.DepositorInserttDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)-BGH polyA tDNA2 FRT-HygromycinR
UseMinimal backbone fragment for low-copy bacterial …ExpressionMammalianAvailable SinceFeb. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
1518_pAAV-U6-SA-eGFP-gRNA-HLP-SACas9-HA-OLLAS-spA
Plasmid#109316PurposePlasmid for liver-specific expression of AAV SaCas9 with a gRNA against eGFPDepositorInserteGFP gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.luxR(mut)-sggfp(C)
Plasmid#236043PurposeThe plasmid pQdCas12a.luxR(mut)-sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene. Additionally, it contains a mutation in the luxR gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA_936
Plasmid#216094PurposeCas12a [EnAs] knockout targeting CD46, CD47, CD55, CD81, positive controlDepositorInsertCD46, CD47, CD55, CD81 guides
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G2_Dual_sgRNA
Plasmid#173201PurposeCoselection for ABE or NHEJ in human cells. Vector for tandem expression of ATP1A1 G2 sgRNA with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA
UseCRISPRExpressionMammalianPromoterTandem U6 promotersAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
RNF130 shRNA-TRE
Plasmid#225336PurposeshRNAmir backbone under tet-operator for RNA interference, with YFPDepositorInsertRNF130 shRNA (Rnf130 Mouse)
UseAAV and RNAiExpressionMammalianPromoterTRE (tetracycline-responsive element)Available SinceSept. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
PX458_AHR_1
Plasmid#101076PurposeEncodes gRNA for 3' target of human AHRDepositorInsertgRNA against AHR (AHR Human)
UseCRISPRAvailable SinceOct. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgAmotl2 v3
Plasmid#158602Purposelenti-viral construct with Cas9, Cre recombinbase and U6 driven sgRNA against mouse Amotl2DepositorInsertAmotl2 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYSD313
Plasmid#212931PurposeEncodes the Aga2 signal peptide, mRuby2 fluorescent protein HA-tagged Sed1p yeast surface display anchor protein with pTEF1 promoter, tTDH1 terminator, LEU2 selectable marker and CEN/ARS yeast origin.DepositorInsertSed1 (SED1 Budding Yeast)
ExpressionYeastAvailable SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLVX-mCherry-SPASTIN
Plasmid#180647PurposeLentiviral expression vector for SPASTIN. Used for generating cell lines. Has N-terminal mCherry tag. SPASTIN starts on M87. Dox-inducible. Internal ID: WISP20-43.DepositorInsertSPASTIN
UseLentiviralTagsmCherryExpressionMammalianMutationStarts at M87, has siRNA resistance to GAACAGUGUG…Available SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.shHmga2
Plasmid#32399DepositorAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
KIF20A D5.2 gRNA
Plasmid#90718Purpose3rd generation lentiviral gRNA plasmid targeting human KIF20ADepositorInsertKIF20A (Guide Designation D5.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-MYB-shRNA
Plasmid#25790DepositorAvailable SinceJuly 13, 2010AvailabilityAcademic Institutions and Nonprofits only -
pHelper-T7IS1
Plasmid#140631PurposeExpresses ShCAST under the T7 promoter and an empty sgRNADepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA targeting IS1 (Escherichia coli)
UseCRISPR; TransposonExpressionBacterialAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 U6-SaDMDR7-U6-SaDMDL2
Plasmid#78603PurposeAAV vector containing gRNAs (for SaCas9) targeting Dmd introns 22 and 23DepositorInsertU6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRExpressionMammalianPromoterU6Available SinceOct. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSMP-EZH1_1
Plasmid#36359DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
MiniCoopR U6:gRNA p53, mitfa:Cas9
Plasmid#118841PurposeTargets tp53 and expresses zebrafish mitfa specifically in zebrafish melanocytesDepositorInserttp53 gRNA (tp53 Zebrafish)
UseCRISPR; Tol2Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1-FAK-HA-V744G
Plasmid#35040DepositorInsertfocal adhesion kinase (Ptk2 Mouse)
Tags2x HA and mCherryExpressionMammalianMutationGFP-FAK-V744G was generated from GFP-FAK using th…Available SinceMarch 8, 2012AvailabilityAcademic Institutions and Nonprofits only