171,035 results
-
Plasmid#238646PurposeExpress NanoLuc-CBP Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertCBP (CREBBP Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET BiBRET Vector, HaloTag-KRAS(G12C)_BRAF-NanoLuc
Plasmid#238566PurposeExpress HaloTag-KRAS(G12C)_BRAF-NanoLuc Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNATagsHaloTag (R) and NanoLuc (R)ExpressionMammalianMutationG12CPromoterCMVAvailable SinceSept. 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
NanoBRET Assay Vector, ARAF-NanoLuc
Plasmid#236876PurposeExpress ARAF-NanoLuc(R) in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertARAF (ARAF Human)
TagsNanoLuc (R)ExpressionMammalianMutationNonePromoterCMVAvailable SinceSept. 12, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGY214
Plasmid#239805PurposeExpress EGFP and mRFP1 simultaneously in filamentous fungiDepositorInsertsEGFP
mRFP1
UseFungal expressionPromoterTef1INAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA_mIGg2a_Anti-DYKDDDDK [M2] v2
Plasmid#236293PurposeMammalian vector expressing Anti-DYKDDDDK [M2] variable region fused to mouse IgG2a heavy chain; to be used with pcDNA_mK-Anti_DYKDDDDK [M2] v2 light chain (Plasmid 236294) to make the antibody.DepositorInsertAnti-DYKDDDDK [M2] heavy chain variable region fused to mouse IgG2a heavy chain
TagsMouse IgG2a FcExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA_mK-Anti_DYKDDDDK [M2] v2
Plasmid#236294PurposeMammalian vector expressing Anti-DYKDDDDK [M2] variable region fused to mouse Kappa light chain; to be used with pcDNA_mIGg2a_Anti-DYKDDDDK [M2] v2 heavy chain (Plasmid 236293) to make the antibody.DepositorInsertAnti-DYKDDDDK [M2] light chain variable region fused to mouse kappa light chain
ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGEX-4T-3-GST-Tev-Af1521(K35E/Y145R)-myc
Plasmid#196241PurposeN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site located between the GST tag and Af1521 and a myc tag on the C terminusDepositorInsertN-terminal GST fusion of Af1521(K35E/Y145R) with a TEV protease site between GST and Af1521 encoding a C-terminal myc tag
TagsGST tag and myc tagExpressionBacterialMutationamino acid 35 lysine is replaced with glutamic ac…Available SinceAug. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
CBP (bd1)-NanoLuc Fusion Vector
Plasmid#236945PurposeExpress CBP (bd1)-NanoLuc(R) Fusion Protein in Mammalian Cells under a CMV promoterDepositorHas ServiceDNAInsertCBP (CREBBP Human)
TagsNanoLuc (R)ExpressionMammalianMutationBromodomain 1PromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
MZB053
Plasmid#217835PurposeBacterial expression of human AP3B1 (1-677) and AP3M1 AP-3 core hemicomplexDepositorTagsGSTExpressionBacterialMutationRemoved residues 678-1094 from AP3B1Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn INTRON mEmerald-STIM1 WPRE
Plasmid#236234PurposeAAV expression of mouse STIM1 internally tagged with mEmeraldDepositorAvailable SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBMN-SRF
Plasmid#232629PurposeLentiviral plasmid expressing human SRF.DepositorAvailable SinceApril 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH941
Plasmid#230846PurposeEf1a-DivA-BE-T2A-GFP-wPREDepositorInsertDivA-BE
UseLentiviralExpressionMammalianAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSEVA26x
Plasmid#190438PurposeEmpty pSEVA26x vector.DepositorArticleTypeEmpty backboneUseSynthetic BiologyAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
WNV NS2B-NS3 protease (catalytically active, self cleave); aliases: West Nile Virus NS2B-NS3 fusion protein
Plasmid#204795PurposeBacterial expression of a fusion of West Nile NS2B-NS3 proteinsDepositorInsertWest Nile NS2B-NS3 fusion
ExpressionBacterialAvailable SinceAug. 29, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJP_Ctrl10
Plasmid#219672PurposeContains PT3lacO promoter (regulated by blue light and LacI) controlling the expression of mCherry. LacI is constitutively produced by pR promoter.DepositorInsertsmCherry
lacI
PromoterPT3lacO and pRAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJP_Rep00
Plasmid#219677PurposeLight-inducible repressilator (modified from pLPT107). PT3lacO promoter controls the expression of TetR node.DepositorInsertPT3lacO
UseSynthetic BiologyPromoterPT3lacOAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
LAMTOR1-APEX2
Plasmid#215556PurposeStable, inducible expression in lysosomeDepositorInsertLAMTOR1-EGFP-Flag tag-APEX2-NES
UseLentiviralAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
FGF8-P2A-iCre
Plasmid#210800PurposeRecombinase reporter for FGF8 expressionDepositorInsertFGF8 (FGF8 Human)
UseCre/LoxTagsiCreExpressionMammalianPromoterendougeneous FGF8 promoterAvailable SinceJuly 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPRC5C-DuET
Plasmid#213297PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
GPRC5A-DuET
Plasmid#213295PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorAvailable SinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P_G90V_G97V
Plasmid#207847PurposeBLaTM-System; Antiparallel negativecontrol EmrE_TMD4_3P_G90V_G97V in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_EmrE_TMD4_3P
Plasmid#207846PurposeBLaTM-System; Antiparallel positive control EmrE_TMD4_3P in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBla_1.2_GpA_wt
Plasmid#207842PurposeBLaTM-System GpA wt positive control in NBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
CBLa_1.2_GpA_wt
Plasmid#207843PurposeBLaTM-System GpA wt positive control in CBLa 1.2 vectorDepositorInsertN-BLa 1.2 fusion protein
TagsFlagExpressionBacterialAvailable SinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSEVA251_ Ptrc.x.tetO2::D-HicDH
Plasmid#185456PurposeCDS of D-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 under the control of the synthetic promoter Ptrc.x.tetO2 and the RBS BBa_B0030 in pSEVA251 plasmid.DepositorInsertD-HicDH from Lactobacillus paracasei DSM 20008
ExpressionBacterialPromoterPtrc.x.tetO2Available SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-ZNF752
Plasmid#88486PurposeDonor Vector containing ZNF752 transcription factor, part of the Human TFome CollectionDepositorInsertZNF752 (ZFP3 Human)
UseGateway donor vectorMutationLast nucleotide of stop codon removed to allow fo…Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDZ114
Plasmid#159357PurposeExpresses sfYFP tagged with ssrA from the Pcin promoterDepositorInsertsfYFP
UseSynthetic BiologyPromoterPcinAvailable SinceSept. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQY527A
Plasmid#166949PurposeLentiviral plasmid expressing Halo-tagged SFPQ Y527A protein from the EF1a promoterDepositorAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG G-CEPIA1er
Plasmid#105012PurposeER calcium sensorDepositorInsertG-CEPIA1er
ExpressionMammalianPromoterpCAGAvailable SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
SaCas9 TadCBEd
Plasmid#193845PurposeExpress TadCBEd (with SaCas9) in mammalian cellsDepositorInsertTadCBEd with SaCas9
ExpressionMammalianAvailable SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-OMP25
Plasmid#141150PurposeFluorescent labeling of the outer mitochondrial membrane (OMM) in mammalian cellsDepositorInsertOMP25 (Synj2bp Rat)
TagsAcGFPExpressionMammalianMutationOMP25 c terminus from addgene plasmid #69598PromoterCMVAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcmv3-IRG1-HA
Plasmid#198181PurposeMammalian expression of HA-tagged human ACOD1 (IRG1)DepositorInsertACOD1 (ACOD1 Human)
TagsHAExpressionMammalianMutationHA tag is added to C-terminal of target proteinPromoterCMVAvailable SinceApril 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
PIK3CA - Exon20 H1047R
Plasmid#16639DepositorAvailable SinceMarch 10, 2008AvailabilityAcademic Institutions and Nonprofits only -
pCVL Traffic Light Reporter 1.1 (Sce target) Ef1a BFP
Plasmid#31481DepositorInsertTraffic Light Reporter 1.1 (Sce target) EF BFP
UseLentiviralMutationmCherry contains M9S and M16L to reduce backgroun…Available SinceAug. 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
GFP-BAZ2A
Plasmid#65373PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
R777-E285 Hs.ROCK2
Plasmid#70569PurposeGateway ORF clone of human ROCK2 [NM_004850.3] with stop codon (for native or N-terminal fusions)DepositorInsertROCK2 (ROCK2 Human)
UseGateway entry cloneAvailable SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-gfap(Intron1/5'/Exon1-zebrafish)
Plasmid#39761DepositorAvailable SinceAug. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRS300
Plasmid#22846PurposeBackbone for expressing plant artificial miRNAsDepositorAvailable SinceJan. 4, 2010AvailabilityAcademic Institutions and Nonprofits only -
FLT3-MSCV-IRES-GFP
Plasmid#184778PurposeExpresses wildtype FLT3 in mammalian cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LVXN-Neo-NSD2
Plasmid#86010Purposeexpress wild-type NSD2 in mammalian cellsDepositorInsertNSD2 (NSD2 Human)
UseLentiviralTagsFlag tag D Y K D D D D KExpressionBacterialMutationK1002R (please see depositor comments below)PromoterCMVAvailable SinceJan. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRE-ChrimsonR-mCherry
Plasmid#92207PurposeReporter constructDepositorHas ServiceAAV1InsertChrimsonR-mCherry
UseAAVExpressionMammalianPromoterTREAvailable SinceJune 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB5318
Plasmid#204828PurposeAn integrating plasmid containing both the inducible enotetS promoter and the coding sequence of the TetR repressor under the control of the constitutive CMV promoter.DepositorInsertstetR
mECitrine
ExpressionYeastPromoterCMV promoter and enotetS promoterAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-dTAG
Plasmid#207683PurposeEmpty N-terminus donor cassette. Integrate homology arms to target the N-terminus insertion of a Blast-2A-dTAG cassetteDepositorTypeEmpty backboneUseCRISPR; Donor cassetteExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCDH-CMV-mC-G-LC3B-P
Plasmid#124974Purposeevaluate autophagyDepositorInsertmCherry-GFP-LC3B
UseLentiviralPromoterCMVAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX333-T2A-EGFP
Plasmid#197417PurposeSpCas9-T2A-EGFP with dual sgRNA cloning backbonesDepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterCBh; U6Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mEGFP-NUP98-DDX10
Plasmid#237640PurposeFor overexpression of mEGFP-NUP98-DDX10DepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti PGK BirA Hygro (w874-1)
Plasmid#29649DepositorInsertBirA
UseLentiviralExpressionMammalianAvailable SinceMay 11, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHR-BRD4ΔN-mCherry-sspB
Plasmid#121968PurposeExpresses fusion of disordered protein BRD4(462-1362), fluorescent protein mCherry, and sspB which upon light activation binds to iLID.DepositorInsertBRD4 (BRD4 Human)
UseLentiviralTagsmCherry-sspBExpressionMammalianMutationDeleted amino acids 1-461PromoterSFFVAvailable SinceApril 9, 2019AvailabilityAcademic Institutions and Nonprofits only