We narrowed to 170,823 results for: Gene
-
Plasmid#71698PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag (AaTrxB1H6)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialPromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-49: MYL2-mEGFP
Plasmid#114414PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL2, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL2 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL2 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-hBVRA
Plasmid#100285PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for human BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for human BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
AICSDP-46: MYL7-mEGFP
Plasmid#114413PurposeHomology arms and linker-mEGFP sequence for C-terminus tagging of human MYL7, via Cas9-excisable CAGGS-mCherry selection cassetteDepositorInsertMYL7 Homology Arms with linker-mEGFP and Cas9-excisable selection cassette (MYL7 Human)
UseCRISPR; Donor templateTagslinker-mEGFPExpressionMammalianMutationhomology arms contain point mutations to disrupt …Available SinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-PHFF-sh-mBVRA
Plasmid#100286PurposeExpression vector for phycocyanobilin (PCB) synthesis and shRNA for mouse BVRA gene in mammalian cellsDepositorInsertsMTS-PcyA-FLAG-P2A-MTS-HA-HO1-P2A-MTS-Myc-Fd-P2A-MTS-Fnr-T7 (synthetic genes)
shRNA for mouse BVRA
TagsFLAG, T7 and Mitochondria-targeting sequence (MTS…ExpressionMammalianMutationAll genes are codon-optimized for expression in h…PromoterCAG promoter and H1 promoterAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
iMb-Notch-Mosaic (IR99.40)
Plasmid#99749PurposeRosa26 gene targeting vector to induce a Cre-dependent mosaic of cells expressing different membrane localized fluorescent proteins and Notch signalling genesDepositorInsertMbYFP, MbTomato, MbKate2, DN-Rbpj and NICD-PEST
UseCre/Lox and Mouse TargetingExpressionMammalianAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHL-EF1a-SphcCas9(D10A)-iP-A
Plasmid#60600PurposeExpresses D10A mutant (nickase) of human codon-optimized Cas9 (derived from Streptococcus pyogenes) and pruomycin resistance gene.DepositorInsertsCRISPR Cas9 D10A
puromycin resistance gene
UseCRISPRExpressionMammalianMutationChanged Asp 10 to Ala, Codon usage optimized for …Available SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGGG L2 TaStb15
Plasmid#226630PurposeWheat transformation vector used to express wheat Septoria tritici blotch (Stb) resistance gene 15DepositorInsertTriticum aestivum (wheat) Septoria tritici blotch 15 (TaStb15) disease resistance gene
UseSynthetic BiologyExpressionPlantPromoterNative TaStb15Available SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDOC-GG
Plasmid#149377PurposeChassis plasmid for building mutagenesis cassettes by Golden Gate assembly to form a donor plasmid for recombineering by Gene DoctoringDepositorInsertsFragment containing a kanamycin resistance cassette
Fragment containing pMB1 origin of replication and an I-SceI recognition sequence
Fragment containing a lacZ⍺ expression cassette flanked by BsaI sites
Fragment containing an I-SceI recognition sequence
UseSynthetic BiologyExpressionBacterialAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBBR1MCS-2
Plasmid#85168PurposeMobilisable shuttle and expression vector. Replicates in many Gram-negative bacteria. Has multiple cloning site with blue/white selection function. Cloned genes driven by derepressed lac promoter.DepositorHas ServiceCloning Grade DNATypeEmpty backboneExpressionBacterialPromoterConstitutive (derepressed P-lac)Available SinceNov. 8, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDblet
Plasmid#8848DepositorInsertARS doublet
UseYeast cloning vectorExpressionYeastMutationThis vector contains, between AatII sites, a dire…Available SinceApril 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
Equalizer-L plasmid
Plasmid#169732PurposeEqualizer variant plasmid with low eGFP output levels but the best gene dosage compensation capability.DepositorInsertmiR(FF4) target-tetR-P2A-eGFP-miR(FF4) target-miR(FF4)
UseSynthetic BiologyExpressionMammalianPromoterpCMV-tetO2Available SinceJune 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pdCas9-bacteria
Plasmid#44249PurposeaTc-inducible expression of a catalytically inactive bacterial Cas9 (S. pyogenes) for bacterial gene knockdownDepositorInsertdCas9 (bacteria)
UseCRISPRExpressionBacterialMutationD10A H840A (catalytically inactive)PromoterpLtetO-1Available SinceApril 11, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLVX_TRE3G_DD::mCherry
Plasmid#108679PurposeTunable system for controlled gene expression and protein stability in mammalian cellsDepositorInsertDestabilizing Domain (DD) mCherry fusion protein
UseLentiviralTagsDD::mCherry fusion proteinExpressionMammalianPromoterDoxycycline inducibleAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pgRNA-humanized
Plasmid#44248PurposeExpression of customizable guide RNA (gRNA) under cotnrol of murine U6 promoter, also contains a CMV-puro-t2A-mCherry expression cassette for mammalian gene knockdownDepositorInsertguide RNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPEPY-PF6-lacI
Plasmid#85589PurposeWork as template for amplification of Streptococcus pneumoniae adapted lacI gene, which is flanked by up- and downstream sequence for integration in prsA locus in S. pneumoniaeDepositorInsertlacI
ExpressionBacterialPromoterPF6Available SinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
M249-5'csr-1-Pgsy-1-luciferase-Bar-3'csr-1
Plasmid#89693PurposeLuciferase reporter plasmid targeted at csr-1 locusDepositorInsertgsy-1 promoter, luciferase
UseYeast episomal vectorTagsluciferasePromotergsy-1Available SinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
p101_CRISPRai_PiggyBac
Plasmid#213777PurposeExpresses Tet-On inducible CRISPRai orthogonal system with VPR-dSaCas9, dSpCas9-KRAB-BFP, zeocin resistance gene, and Tet-On transactivator. PiggyBac vector.DepositorInsertsVPR-dSaCas9
dSpCas9-KRAB-BFP
zeocin
Tet-On transactivator
UseCRISPRPromoterEF1a (EF-1-alpha intron a) and Tet_On_TREAvailable SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKL2299
Plasmid#186332PurposeThis plasmid carries the majority suite of Agrobacterium virulence genes from Ti plasmid pTiBo542. The additional copies of vir genes enhance Agrobacterium-mediated plant transformation.DepositorInsertvirulence genes from Agrobacterium tumefaciens pTiBo542
ExpressionBacterialAvailable SinceOct. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAP01
Plasmid#59981PurposeThe function of this material is to facilitate the capture and expression of bacterial gene clusters.DepositorTypeEmpty backboneUseSynthetic Biology; Transformation-associated reco…TagsnoExpressionBacterial and YeastPromoternoAvailable SinceNov. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCRU5-inGFPt
Plasmid#60236PurposeHTLV-1 based transfer vector encoding gfp-turbo reporter gene interrupted by intronDepositorInsertinGFPt
UseRetroviralAvailable SinceAug. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE
Plasmid#32702PurposeConditional overexpression vector. Deletion of dsRed by Cre recombinase results in the rapid loss of dsRed and the activation of your gene fused to eGFP expression.DepositorInserteGFP
UseCre/Lox and RetroviralExpressionMammalianAvailable SinceDec. 13, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P11
Plasmid#120022PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with mScarlet-iDepositorInsertmScarlet-i
UsePcr templateTagsmScarlet-iPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHeACT-mEGFP-NLS
Plasmid#205003PurposeThe vector contains 1kbp of the upstream and downstream regions of the actin gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the actin gene from Hypsibius exemplaris
UseTardigrade expressionAvailable SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUPV3L1-HA WT
Plasmid#232348PurposeExpresses human SUPV3L1/SUV3 in mammalian cells with HA tagDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-idCas9-vpr
Plasmid#89985Purposeinducible CRISPR-ON system for controllable gene activation; this plasmid is used to insert dCas9-VPR casette in one allele of AAVS1 locusDepositorInsertdCas9-VPR
ExpressionMammalianPromoterTRE-tightAvailable SinceJune 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAluYa5-neo-TET
Plasmid#51283Purposeexpresses Alu, a human SINE, using the pol III enhancer sequence of the 7SL gene and tagged with the self splicing intron neo cassetteDepositorInsertAluYa5
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoterupstream pol III enhancer sequence of the 7SL gen…Available SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSLC-242
Plasmid#73189PurposeTemplate plasmid which encodes chloramphenicol resistance gene for positive selection and a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) for negative selection.DepositorInsertchloramphenicol (cat Although Ampicillin gene is present, it was inactivated while cloning.)
ExpressionBacterialPromoterchloramphenicol promoterAvailable SinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SEMPER-mARG_ACC-gvpA_ACC-gvpNJKFGW-EmGFP_IRES-mCherry
Plasmid#221080PurposeSEMPER plasmid for expression of gas vesicles using mammalian acoustic reporter genes (mARGs)DepositorInsertACC-gvpA_ACC-gvpNJKFGW-EmGFP_IRES-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-Basic-hCYP26A1P-E4-mCherry
Plasmid#135478PurposeHuman short form promoter of human gene in pGL3-Basic-mCherry plasmid vector (Namely, E4.2)DepositorInsertmCherry Open reading Frame
UseUnspecifiedPromoterShort from promoter of human CYP26A1 (312 bp)Available SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS-mEGFP-loxP-P2A-dTKneo-pA-loxP
Plasmid#139484PurposePCR template for mEGFP gene knock-in donor vectorDepositorInsertmEGFP-loxP-P2A-dTKneo-pA-loxP
TagsmEGFPExpressionMammalianPromoterCAG promoterAvailable SinceApril 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPbU6_hdhfr/yfcu_Cas9
Plasmid#216423PurposeEmpty backbone to express gene specific gRNA from the Plasmodium berghei U6 promoter and the Cas9 nuclease for traditional CRISPR editing.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG Cas9-2A-Citrine
Plasmid#92358PurposeCAG-driven ubiquitous expression of Cas9. Contains 2A-Citrine reporter. For CRISPR mediated gene knockouts in chicken embryos.DepositorInsertCas9 2A Citrine
ExpressionMammalianAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
SUPV3L1-HA G207V
Plasmid#232349PurposeExpresses human SUPV3L1/SUV3 (G207V) in mammalian cells with HA tagDepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPaint-T2A-LexGAD-3xP3-RFP
Plasmid#127558PurposeCRISPaint universal donor plasmid for gene exon insertion. Encodes T2A-LexGAD-SV40 and 3xP3-RFP visible eye marker.DepositorInsertLexGAD
UseCRISPRExpressionInsectAvailable SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHeEf1a-mEGFP-NLS
Plasmid#205012PurposeThe vector contains 1kbp of the upstream and downstream regions of the ef1a gene from Hypsibius exemplaris, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the ef1a gene from Hypsibius exemplaris
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
mouse Clock delta 19
Plasmid#177312Purposeexpression of mutant mouse clockDepositorInsertmouse clock delta 19
ExpressionMammalianMutationdeletion from original mClock gene (514-564aa)PromoterCMVAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSB161 - pL2_pSB90_2x35S::GUS::tMAS
Plasmid#123197Purposebinary plant vector for transient expression of GUS (with introns)DepositorInsert2x35S::GUS::tMAS
ExpressionPlantAvailable SinceMay 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
Vmn2r1-5Hprt-loxP TV
Plasmid#108079PurposeTergeting vector for Vmn2r1 gene knockout mice (∆C1 strain)DepositorInsertVmn2r1-Hprt (5')-loxP-neo (Vmn2r1 Mouse)
UseMouse TargetingAvailable SinceMay 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P19
Plasmid#124789PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with mCherry-mNeonGreenDepositorInsertmCherry-mNeonGreen
UsePcr templateTagsmCherry-mNeonGreenPromoterNoneAvailable SinceMay 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
JD136
Plasmid#229497PurposeAdenoviral helper plasmid containing E2A and L4-22k/33k and VA RNA I genesDepositorInsertE2A, L4-22k/33k, VA RNA I
UseAAV and AdenoviralExpressionMammalianPromoterwt promoterAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330a dCas9-VP64
Plasmid#92363PurposeModified CAG promoter-containing vector for ubiquitous expression of catalytically inactive Cas9 fused to VP64 transcriptional activation domain. For targeted gene activation in chicken embryos.DepositorInsertdCas9-VP64
UseCRISPRExpressionMammalianPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pRvTUB-mEGFP-NLS
Plasmid#205011PurposeThe vector contains 1kbp of the upstream and downstream regions of the tubulin gene from Ramazzottius varieornatus, with the mEGFP gene with NLS sequence positioned in between.DepositorInsertmEGFP-NLS flanked by 1kbp upstream and downstream of the tubulin gene from R. varieornatus
UseTardigrade expressionAvailable SinceAug. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMaCTag-P29
Plasmid#120040PurposeTemplate for C-terminal PCR tagging of mammalian genes (Puromycin selection) with Strep-IIDepositorInsertStrep-II
UsePcr templateTagsStrep-IIPromoterNoneAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pB2-neo-TET
Plasmid#51287Purposeexpresses the rodent SINE, B2, using the pol III enhancer sequence of the 7SL gene and tagged with the self splicing intron neo cassetteDepositorInsertsine B2
TagsneoTET cassette with a tetrahymena self-splicing …ExpressionMammalianPromoterenhancer from 7SL geneAvailable SinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMC_mNG2(11)_BSDminus_F2
Plasmid#184164PurposeDonor cassette plasmid for high-throughput tagging, encoding an mNG2(11) synthetic exon in frame 2, as well as a blasticidin resistance gene for selection of genomic integrants.DepositorInsertsmNG2(11)
bsd
UseCRISPRAvailable SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPbHiT_3xmyc_hsp70UTR_hdhfr/yfcu
Plasmid#216421PurposeEmpty backbone to express gene specific gRNA and carry the homology repair template for CRISPR editing of Plasmodium berghei using the PbHiT system.DepositorTypeEmpty backboneUseCRISPR; Expression in plasmodium bergheiTags3xmycExpressionBacterialAvailable SinceApril 28, 2024AvailabilityAcademic Institutions and Nonprofits only