We narrowed to 14,123 results for: cas9 genes
-
Plasmid#206288PurposeBacterial expression of SpCas9 Δcys E532C and E945C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E945CPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDL26_Cas9-His Δcys M1C/E532C
Plasmid#206287PurposeBacterial expression of SpCas9 Δcys M1C and E532C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationM1C, C80S, E532C, C574SPromoterT7Available SinceSept. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUt-mNF-BACH1 Cas9-Resistant
Plasmid#199218PurposeLPUtopia-7 matching RMCE donor plasmid with Cas9-resistant GFP-BACH1 Negative-Feedback circuit (mNF-BACH1 Cas9- resistant). Use BlastR for positive selection and HSV-TK for negative selection.DepositorInserthTetR::P2A::EGFP::BACH1 (BACH1 Human)
TagsEGFPExpressionMammalianMutationsilient mutation at nucleic acid 177 C changed to…PromoterCMV D2ir promoterAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCA17-CRISPR-Tag (11XTS1) for dSpCas9
Plasmid#199448PurposeCRISPR-Tag sequence that can be efficiently bound by dSpCas9DepositorInsertCRISPR-Tag
UseCRISPRAvailable SinceMay 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
lenti-Cas9-Exo-Blast-BFP
Plasmid#196721PurposeSortable and selectable SpCas9 fused to exodeoxyribonuclease I (sbcB) from E. coli. For the creation of longer deletions.DepositorInsertCas9-Exo1-T2A-BSD-TagBFP
UseCRISPR and LentiviralTagsNucleoplasmin NLS and SV40 NLSPromoterEF1aAvailable SinceApril 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-gRNA(SFTPCI73Tcorr)-SpCas9(BB)-2A-GFP
Plasmid#187647PurposeEncodes gRNA to correct the SFTPC I73T mutationDepositorInsertI73T gRNA
UseCRISPRAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-T Easy-Cas9-nls-CDS1
Plasmid#160231PurposeCas9-nuclear localization, level 0 of MoClo Golden Gate position CDS1DepositorInsertCas9-nuclear localization signal gene sequence, Golden Gate MoClo position CDS1
UseLevel 0 of moclo golden gate position cds1Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH321-1-Tier1-PhCMV-dCas9-3xNLS
Plasmid#169595PurposeTier-1 vector encoding PhCMV-driven dCas9-3xNLS expression (PhCMV-dCas9-3xNLS-pA).DepositorInsertdead S.pyogenes Cas9
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-RDH11
Plasmid#161924PurposeTo generate RDH11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against RDH11 exon 2.DepositorInsertsgRNA targeting RDH11 exon 2
UseCRISPRExpressionMammalianPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJCC_162 SpCas9 KES(1107-1109)GG
Plasmid#179526PurposeFor bacterial expression of SpCas9 KES(1107-1109)GG (phosphate lock loop mutant) with an N-terminal His-MBP tagDepositorInsertSpCas9 KES(1107-1109)GG
Tags10X His, TEV protease cleavage site, and maltose-…ExpressionBacterialMutationreplaced KES (residues 1107-1109) with GGAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-B2
Plasmid#165083PurposegRNA 2 of pair B for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C1
Plasmid#165085PurposegRNA 1 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-Puro (PX462) V2.0 Stx5DL-C2
Plasmid#165086PurposegRNA 2 of pair C for Stx5L-specific knockoutDepositorInserthSpCas9n-2A-Puro
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterCMVAvailable SinceNov. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-TREX1 g3 Cas9-T2A-mCherry
Plasmid#164252PurposeTranscription of TREX1 guide RNA and Cas9 expression for CRISPR/Cas9 in mammalian cellsDepositorInsertsgTREX1
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 nickase D10A Cas9 (GB1691)
Plasmid#160588PurposeNickase D10A Cas9 for Nt fusion.DepositorInsertnickase D10A Cas9
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCbh-SpyCas9-2A-puro-pA_U6-sgRosa26
Plasmid#149346PurposeMammalian expression vector for SpyCas9, puromycin resistance and mouse Rosa26 guide RNADepositorInsertCas9
UseCRISPRTagsFlag tagExpressionMammalianPromoterCbcAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCbh-SpyCas9-2A-puro-pA_U6-BbsI
Plasmid#149347PurposeMammalian expression vector for SpyCas9 and puromycin resistanceDepositorInsertSpyCas9
UseCRISPRTagsFlag tagExpressionMammalianPromoterCbhAvailable SinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgVamp1
Plasmid#159919PurposeMutagenesis of Vamp1DepositorInsertVamp1 (Vamp1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgNtn1
Plasmid#159907PurposeMutagenesis of Netrin1DepositorInsertNetrin1 (Ntn1 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgDcc
Plasmid#159906PurposeMutagenesis of DccDepositorInsertDcc (Dcc Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
LP102: pMAGIC (R4-R3) NLS-Sp Cas9-NLS
Plasmid#132927PurposepMAGIC R4-R3 entry plasmid, contains 2xNLS SpCas9 (nuclease active) for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInserthumanized SpCas9
UseCRISPR and Synthetic Biology; Pmagic gateway entr…Available SinceOct. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
IH601: pMAGIC (R4-R3) NLS-Sa Cas9-NLS
Plasmid#121827PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS SaCas9 (nuclease) fusion for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-Cas9 (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
A3H HapII R175/6E-Cas9n-UGI
Plasmid#119142PurposeBase editor made from APOBEC3H Haplotype II RNA binding mutant RR175/6EEDepositorInsertAPOBEC3H Haplotype II RR175/6EE-Cas9 nickase-UGI
UseCRISPRMutationA3H Hap II RR175/6EEPromoterCMVAvailable SinceJune 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459V2.0-eSpCas9(1.1)+K810A+K855A
Plasmid#108299PurposepX459 V2.0 (Plasmid #62988) with the K810A, K848A, K855A, K1003A, and R1060A mutationsDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceMay 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196078Purpose(Empty Backbone) Constitutive CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-PGK- dCas9-SunTag-P2A-HygR
Plasmid#193137PurposeExpresses dCas9 fused to the SunTag scaffoldDepositorInsertdCas9-SunTag-T2A-HygR
UseLentiviralPromoterPGKAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196084Purpose(Empty Backbone) Inducible CRISPRi vector conferring puromycin resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Plac-dCas9 (Plac)
Plasmid#105235PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Plac promoter for expression in P. aeruginosaDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable SinceAug. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUC18-mini-Tn7T-Lac-dCas9 (Ptac)
Plasmid#105234PurposeTn7 integrating plasmid with S. pasteurianus dCas9 expressed from the Ptac promoter for expression in P. putida and P. fluorescensDepositorInsertS. pasteurianus dCas9
UseCRISPR and Synthetic BiologyTagsHAExpressionBacterialMutationD10A, H599AAvailable SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Ade2 drive
Plasmid#89577PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Ade2 locusDepositorInsertAde2 gene drive
UseSynthetic BiologyExpressionYeastAvailable SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJK-caCas9-NatMX-Neut5L-Leu2 drive
Plasmid#89578PurposecaCas9 integrating vector into the Neut5L locus with gene drive for targeting Leu2 locusDepositorInsertLeu2 gene drive
ExpressionYeastAvailable SinceOct. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV_hU6-sgRNA_hUbC-dSaCas9-KRAB-T2A-PuroR
Plasmid#162334PurposeLentiviral expression of dSaCas9-KRAB and a sgRNA with puromycin resistanceDepositorInsertdSaCas9-KRAB
UseLentiviralTagsHAExpressionMammalianPromoterhUbCAvailable SinceFeb. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CAG-DDdCas9VP192-T2A-EGFP-ires-puro
Plasmid#69534PurposeDHFR destabilised domain (DD) fused to dCas9VP192 (S.pyogenes) on CAG expression vector. DDdCas9VP192 protein is stabilised by Trimethoprim.DepositorInsertDD-dCas9VP192-T2A-EGFP
TagsC-term T2A-EGFP and DHFR Destabilised DomainExpressionMammalianPromoterCAGAvailable SinceNov. 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-venus-bpA
Plasmid#86986PurposeFor cloning and expression of sgRNA together with expression of a Cas9-Venus fusion proteinDepositorInsertCas9-venus
TagsCas9-Venus fusion proteinExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)sgRNA_CAG-Cas9-bpA_EF1-TagRFP
Plasmid#86987PurposeFor cloning and expression of sgRNA together with expression of Cas9 and TagRFPDepositorInsertCas9
ExpressionMammalianPromoterCAGAvailable SinceApril 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
Gal1/10p CAS9 Gal1/10p I-SceI
Plasmid#182519PurposeGalactose-Induced Expression vector for Cas9 and I-SceI.DepositorInsertsI-SceI
Cas9
ExpressionYeastAvailable SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
Plasmid#196086PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.DepositorInsertgRNA targeting lncRNA NORAD
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
Tagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available SinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196082Purpose(Empty Backbone) Inducible CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Aminoglycoside phosphotransferase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196079PurposeConstitutive CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196085PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBbi-Hyg-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196076Purpose(Empty Backbone) Constitutive CRISPRi vector conferring hygromycin B resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
ExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Bla-dCas9-KRAB-MeCP2_hU6-SapI
Plasmid#196080Purpose(Empty Backbone) Inducible CRISPRi vector conferring blasticidin S resistance, ready for insertion of gRNA targeting gene of interest using SapI restriction sites.DepositorInsertsdCas9-KRAB-MeCP2 repressor
hU6 promoter and gRNA scaffold
Blasticidin S deaminase
UseCRISPRExpressionMammalianMutationCatalytically dead mutant of the Cas9 endonucleas…Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only