We narrowed to 17,375 results for: puro
-
Plasmid#127903PurposeHDR (donor) Plasmid for Inserting PuroR-2A-GFP-AID into the 5' end of the Mouse Srcap GeneDepositorInsertSrcap (Srcap Mustard Weed, Mouse)
UseDonor plasmidTagsGFP, AID, PuroRExpressionMutationPromoterAvailable sinceSept. 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-FLAG-RHEB-IRES-Puro
Plasmid#120576PurposeExpresses Flag-RHEB fusion protein in mammalian cells & for virus productionDepositorInsertRHEB (RHEB Human)
UseLentiviralTagsFlagExpressionMammalianMutationPromoterCMVAvailable sinceJan. 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
p-super-retro puro RhoGDI2 shRNA
Plasmid#58897Purposeproduces an shRNA against RhoGDI2DepositorInsertRhoGDI2 (ARHGDIB Human)
UseRNAiTagsExpressionMammalianMutationPromoterAvailable sinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
integrin beta6 777T pBabe puro
Plasmid#13583DepositorInsertintegrin beta 6 777T (ITGB6 Human)
UseRetroviralTagsExpressionMammalianMutation777T. Lacks last 11 amino acids of cytoplasmic do…PromoterAvailable sinceJan. 8, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup93-SpeI
Plasmid#87331PurposeExpression of shRNA targeting at Nup93DepositorInsertshRNA against human Nup93
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceJune 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -126
Plasmid#50924PurposeU6 driven sgRNA targeting Sox17 -126 bp from TSSDepositorInsertSox17 -126 sgRNA (SOX17 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBabe-Puro-FLAG-Neuroserpin oloop
Plasmid#58262PurposeRetroviral vector for expressing mutated Neuroserpin in mammalian cellsDepositorInsertNeuroserpin (SERPINI1 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationMutant of neuroserpin lacking five residues from …PromoterAvailable sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-shNup88-HindIII
Plasmid#87329PurposeTo express shRNA against human Nup88DepositorInsertshRNA against human Nup88
UseRNAiTagsExpressionMammalianMutationPromoterH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro U6 sgRNA SOX17 -296
Plasmid#50926PurposeU6 driven sgRNA targeting Sox17 -296 bp from TSSDepositorInsertSox17-296 sgRNA (SOX17 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceJan. 22, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-R66A
Plasmid#241369PurposeLentiviral expression of mutant Rac1DepositorInsertRac1 (RAC1 Human)
UseLentiviralTagsExpressionMutationR66APromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-IRES-PURO-RAC1-Y64F
Plasmid#241370PurposeLentiviral expression of mutant Rac1DepositorInsertRac1 (RAC1 Human)
UseLentiviralTagsExpressionMutationY64FPromoterCMVAvailable sinceAug. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSPcas9(BB)-2A-Puro V2.0 sgCHMP2B-2 aauucccaaaugaagauggc
Plasmid#231998PurposeExpression of an sgRNA targeting CHMP2B, Cas9, and a PuroR markerDepositorInsertCHMP2B-targeted sgRNA (CHMP2B Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEF1a mNeonGreen-3K-B1-10-IRES-mKate2-2A-PuroR
Plasmid#215377PurposeLentiviral expression of a cytosolic-localized split mNeonGreen variant that enables efficient complementation when the missing beta strand is present. mKate2 is present as a transduction control.DepositorInsertmNeonGreen-3K-1-10
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Lenti-E14-ABE-Cas9n-puro
Plasmid#226588PurposeExpress E14-ABE in mammalian cellsDepositorInsertE14-ABE
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pL6puro-pmRevErbA-Venus-NLS-Pest
Plasmid#240105PurposeA lentiviral (yellow) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein)DepositorInsertmurine Nr1d1 promoter+Venus-NLS-Pest-Reporter (Nr1d1 Mouse)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-MFSD6-mNeon-Puro
Plasmid#239955PurposeLentiviral vector to generate mNeon-tagged MFSD6 stable expressing cell line under CMV promoterDepositorInsertMFSD6-mNeon
UseLentiviralTagsmNeonExpressionMammalianMutationPromoterAvailable sinceJuly 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-chGrb2/eDHFR(69K6)-iRFP713
Plasmid#214828PurposeEncoding Grb2-eDHFR(69K6) chimera fused to iRFP713DepositorInsertGrb2(1-59)-eDHFR(69K6)-Grb2(152-216)-iRFP713
UseTagsiRFP713ExpressionMammalianMutationPromoterCAG promoterAvailable sinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-puro-3Ty:OsAID:3Ty (p5229)
Plasmid#239361PurposepPOTv6 based plasmid template for addition of Ty-epitope tagged Rice Auxin Inducible Degradation (AID) domain to genes in trypanosomes with selection using puromycinDepositorInsertRice Auxin inducible degradation domain
UseBacterialTags3 x Ty epitope tagExpressionMutationPromoternoneAvailable sinceJuly 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-pcDNA3.1 Puro-CAG-Positron2
Plasmid#239079PurposeMammalian expression of positive-going voltage sensorDepositorInsertPositron2
UseTagsExpressionMammalianMutationR78K N81D D92N W178FPromoterCAGAvailable sinceJuly 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SV40-puro-EF1a-HA-NLGN1dAChE-bc
Plasmid#220437PurposeExpresses HA-tagged human NLGN1 with K578A/V579A substitutionsDepositorInsertNeuroligin-1 (NLGN1 Human)
UseLentiviralTagsHA-tagExpressionMammalianMutationK578A and V579A substitutionsPromoterEF1aAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP(N55D)-CNOT7-V5H6.MCh.Puro
Plasmid#209949PurposeIn mammalian cells expresses non-binding TP mutant fused to a CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) with a N55D mutation that i…ExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-(inactive)CNOT7-V5H6.MCh.Puro
Plasmid#209936PurposeIn mammalian cells expresses TP fused to an inactive CNOT7 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsEnzymatically inactive CCR4-NOT transcription complex subunit 7 (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6interaction)-V5H6.MCh.Puro
Plasmid#209940PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusCNOT6NOT1interaction)-V5H6.MCh.Puro
Plasmid#209941PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with CNOT6 or NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1 and CNOT6) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh-TP-CNOT7(minusNOT1interaction)-V5H6.MCh.Puro
Plasmid#209942PurposeIn mammalian cells expresses TP fused to a CNOT7 that does not interact with NOT1 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 7 (Mutation to inhibit interaction with NOT1) (CNOT7 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pA-CBh.TP-(inactive)CNOT6-V5H6.MCh.Puro
Plasmid#209943PurposeIn mammalian cells expresses TP fused to an inactive CNOT6 with a V5H6 tag. Also expresses an mCherry fluorescent protein and puromycin resistance marker.DepositorInsertsCCR4-NOT transcription complex subunit 6 (enzymatically inactive) (CNOT6 Human)
mCherry fluorescent protein fused to puromycin resistance marker
UseTagsTP (MS2 coat protein) and V5 epitope with H6 tagExpressionMammalianMutationPromoterCBh and CMVAvailable sinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW PuroR-P2A-COX8ASig-Timer
Plasmid#239559PurposeExpression and mitohcondrial localization of TimerDepositorInsertTimer
UseLentiviralTagsExpressionMutationPromoterUbCAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW H2B-mEmerald-P2A-PuroR
Plasmid#239553PurposeExpression and nuclear localization of mEmeraldDepositorInsertmEmerald
UseLentiviralTagsExpressionMutationPromoterUbCAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW H2B-mCherry-P2A-PuroR
Plasmid#239554PurposeExpression and nuclear localization of mCherryDepositorInsertmCherry
UseLentiviralTagsExpressionMutationPromoterUbCAvailable sinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSG297-(Sp-gRNA)-(Sa-gRNA)-(PuroR_T2A_BFP(C>T screening))
Plasmid#239448PurposeOrthogonal dual Cas9 gRNA and BFP reporter lentivirus cassette plasmid. For use with S. pyogenes and S. aureus gRNAs and includes a BFP reporter which reports on C-to-T editing.DepositorInsertsS.p. gRNA backbone
S.a. gRNA backbone
PuroR-T2A-BFP(C>T_screening)
UseLentiviralTagsExpressionMammalianMutationBFP: T65S, S72S, V145F, K206K, H231LPromoterEF1alpha, U6, and mU6Available sinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA360 - pBA904 Puro-T2A-GFP
Plasmid#238164PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseLentiviralTagsGFPExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA595 - pBA904 Puro-T2A-mCherry
Plasmid#238171PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmCherryExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRCA594 - pBA904 Puro-T2A-BFP
Plasmid#238170PurposeLentiviral CRISPR guide vector expressing a non-targeting sgRNA with cs1 incorporated in the loop of the sgRNA constant region for 10X Direct CaptureDepositorInsertNon-targeting sgRNA
UseCRISPR and LentiviralTagsmTagBFP2ExpressionMutationPromoterAvailable sinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBABE-puro-2xFLAG-2xSTREP-E2F1
Plasmid#236436Purposestable expression of E2F1 using virus infectionDepositorInsertE2F1 (E2F1 Human)
UseTagsFLAG-FLAG-STREP-STREPExpressionMammalianMutationPromoterAvailable sinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_WT-VA
Plasmid#191216PurposeLentiviral expression of SARS-CoV-2 Spike_WT in mammalian cellsDepositorInsertSPIKE_SARS2_WT (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationPromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Alpha-VA
Plasmid#191217PurposeLentiviral expression of SARS-CoV-2 Spike_Alpha in mammalian cellsDepositorInsertSPIKE_SARS2_Alpha (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationDel 69-70 Del 144 N501Y A570D D614G P681H T716I S…PromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Beta-VA
Plasmid#191218PurposeLentiviral expression of SARS-CoV-2 Spike_Beta in mammalian cellsDepositorInsertSPIKE_SARS2_Beta (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationD80A D215G (Del 241-243) K417N E484K N501Y D614G …PromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Delta-VA
Plasmid#191219PurposeLentiviral expression of SARS-CoV-2 Spike_Delta in mammalian cellsDepositorInsertSPIKE_SARS2_Delta (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationT19R 156del 157del R158G L452R T478K D614G P681R …PromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_Spike_Lambda-VA
Plasmid#191220PurposeLentiviral expression of SARS-CoV-2 Spike_Lambda in mammalian cellsDepositorInsertSPIKE_SARS2_Lambda (S SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationG75V T76I Del 246-252 L452Q F490S D614G T859NPromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-SARS-CoV-2_NSP3-VA
Plasmid#191214PurposeLentiviral expression of SARS-CoV-2 NSP3 in mammalian cellsDepositorInsertNon structural protein 3 (ORF1ab SARS CoV-2)
UseLentiviralTagsVA tagExpressionMammalianMutationPromoterCMVAvailable sinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Lenti CMV HA-EGFP Puro
Plasmid#236081PurposeLentiviral backbone expressing N-terminally HA tagged EGFP, control for empty backbone 236079DepositorInsertEGFP
UseLentiviralTagsHAExpressionMutationPromoterCMVAvailable sinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Lenti CMV EGFP-HA Puro
Plasmid#236082PurposeLentiviral backbone expressing C-terminally HA tagged EGFP, control for empty backbone 236080DepositorInsertEGFP
UseLentiviralTagsHAExpressionMutationPromoterCMVAvailable sinceApril 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLVX-TetOne-Puro-LbNOX-Flag
Plasmid#234984PurposeExpresses LbNOX in human cell linesDepositorInsertLbNOX
UseLentiviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-mitoLbNOX-Flag
Plasmid#234985PurposeExpresses mitochondrial LbNOX in human cell linesDepositorInsertmito-LbNOX
UseLentiviralTagsFlagExpressionMammalianMutationPromoterAvailable sinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-PGK-TetOn-Puro_MeltITSN1-37-mch
Plasmid#234068PurposeEncodes the Dbl homology and pleckstrin homology (DH-PH) domain of Intersectin1 controlled by a Melt variant with a switching temperature of 37°CDepositorInsertMeltITSN1-37-mCherry
UseLentiviralTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
XZ076 (PB) CMV-mCCL20 (PuroR-BFP)
Plasmid#233433PurposePiggyBac donor plasmid, membrane-bound CCL20DepositorInsertCCL20-pre-mGRASP
UseTagsExpressionMammalianMutationWTPromoterCMVAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#1-puro
Plasmid#231984PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk1_#2-puro
Plasmid#231983PurposeKnockout mouse Ripk1DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk1 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro human RLIM N581K
Plasmid#232242PurposeMammalian expression of Human RLIM N581KDepositorInsertHuman RLIM N581K (RLIM Human)
UseTagsExpressionMammalianMutationN581KPromoterAvailable sinceFeb. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgRipk3_#2-puro
Plasmid#231982PurposeKnockout mouse Ripk3DepositorInsertsgRNA with Cas9 with puromycin resistance (Ripk3 Mouse)
UseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only