We narrowed to 15,163 results for: GRN
-
Plasmid#17471PurposeGateway entry vector for EGFPshRNA#2 under H1/TO promoterDepositorInsertEnhanced green fluorescent protein shRNA #2
UseGateway Cloning and RNAiAvailable SinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
LRG/Foxa1 e2.4
Plasmid#105511PurposeLentiviral expression of Foxa1 DNA-binding domain (exon 2) targeting sgRNADepositorInsertFoxa1 (sgRNA, e2.4)
UseLentiviralAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGY037 BSMV-gamma-AmCyan
Plasmid#234818PurposeTo express flourescent protein AmCyan from the gamma genome of Barley Stripe Mosaic Virus Vector (T-DNA)DepositorInsertAmCyan
ExpressionPlantAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYAP1-9
Plasmid#193668PurposeTet inducible knockdown of YAP1DepositorInsertYAP1 (YAP1 Human)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO5d.SFFV.dTomato-miR30n
Plasmid#90334PurposemiR30 based shMir knockdownDepositorInsertsdTomato
na
SFFV
miR30n
UseLentiviralAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9D10Anickase.EF1a-BFP.sgLMNApair3
Plasmid#98974PurposeCas9 Homologous Recombination Reporter. SpCas9D10A nickase and a pair of sgRNAs targeting hLMNA. Generates breaks with 37bp 3' overhangs. TagBFP.DepositorInsertLMNA sgRNAs pair 3 and Cas9(D10A)
ExpressionMammalianAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pENTR221-H1-sgHTT1-U6-sgGFP2-7SK-sgCas9
Plasmid#87917PurposeGateway cloningDepositorInsertsgHTT1, sgGFP2, shCas9
ExpressionMammalianPromoterH1, U6, 7SKAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIRECT_25I
Plasmid#91146PurposeDirect Cloning, Type: T-DNA, Engineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers, Plant Selection: PvUbi2:hpt IIDepositorInsertEngineering Reagent: ZmUbi:Csy4-P2A-TaCas9_dead + PvUbi1:gRNAs with Csy4 spacers
UseCRISPRExpressionPlantMutationD10A, H840AAvailable SinceJuly 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC39
Plasmid#62333PurposesgRNA + 1x PP7 with mCherry for mammalian cellsDepositorInsertssgRNA + 1x PP7
mCherry
UseLentiviralExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U6
Plasmid#173157PurposeSingle guide RNA cassette under U6 promoterDepositorInsertsgRNA cassette under U6 promoter
ExpressionPlantPromoterAtU6-26Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459-APP-KO
Plasmid#176487PurposeTo knockout APP geneDepositorInsertgRNA sequence
UseCRISPRAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
-
SGL40C.EFS.RFP657
Plasmid#69147PurposeAdvanced lentiviral Vector for sgRNA (hU6 Promoter) delivery with RFP657 expression (EFS Promoter)DepositorInsertssgRNA
EFS
tagRFP657
Available SinceAug. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#2
Plasmid#174145PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorInsertRB1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEE390
Plasmid#149280PurposeT-DNA encoding TRV2 with gRNA targeting NbPDS3DepositorInsertp35S:TRV2_NbPDS3sgRNA:tNos
ExpressionPlantPromoter35SAvailable SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
GOLPH3 shRNA
Plasmid#163860PurposeshRNA targeting the coding sequences of GOLPH3DepositorInsertgolgi phosphoprotein 3 (GOLPH3 Human)
ExpressionMammalianAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPU-huTRIMmiR30-TRIM5
Plasmid#132938PurposeAll-in-one huTRIM5 rescue-TRIM5 shRNA knockdownDepositorInserthuman TRIM5
UseLentiviral and RNAiExpressionMammalianPromoterSFFVAvailable SinceOct. 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shFXN_1
Plasmid#102970PurposeSuppression of FXNDepositorInsertshFXN_1 (FXN Human)
UseLentiviral and RNAiAvailable SinceDec. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_2
Plasmid#102969PurposeSuppression of ABCB7DepositorInsertshABCB7_2 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shABCB7_1
Plasmid#102968PurposeSuppression of ABCB7DepositorInsertshABCB7_1 (ABCB7 Human)
UseLentiviral and RNAiAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti-Cas9-VQR-GFP_activity_reporter
Plasmid#87156PurposeThis lentiviral vector can be used to assay activity of SpCas9-VQR (NGA PAM restricted).DepositorInsertGFP and sgRNA targeting GFP (NGA restricted)
UseLentiviralAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgNT.2#2/Cre
Plasmid#173661PurposeExpresses a NT.2-targeting gRNA and Cre-recombinaseDepositorInsertNon-targeting gRNA
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
gh19
Plasmid#106703Purposeexpression of gRNA targeting GALNT19DepositorInsertGALNT19
ExpressionMammalianAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_1
Plasmid#86358PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ARID5B_2
Plasmid#86351PurposeEncodes gRNA for 3' target of human ARID5BDepositorInsertgRNA against ARID5B (ARID5B Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCJ1021
Plasmid#228761PurposePlasmid expressing Cas9 and 2 gRNAs for mouse Ift88. Use for disruption of mouse Ift88 in cultured cells.DepositorAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgIREB2_1
Plasmid#169894PurposeDisrupt IREB2DepositorInsertsgRNA targeting IREB2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
RT3GEN
Plasmid#111165PurposeTet-regulated miR-E (miR-30 variant)-based RNAi with tGFP reporterDepositorInsertmiR-E (miR-30 variant)
UseRetroviralMutationWTPromoterT3GAvailable SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 4
Plasmid#59977PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOC1 Halo-Actb KI
Plasmid#183426PurposeCreON knock-in for Halo-beta-actin (amino acid position: before start codon)DepositorInsertgRNA and Halo donor
UseCRISPRAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJW1883
Plasmid#154331PurposesgRNA Target Vector for CRISPRDepositorInsertttTi5605 site targeting sgRNA (F+E) with R07E5.16 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJW1849
Plasmid#154327PurposesgRNA Target Vector for CRISPRDepositorInsertttTi4348 site targeting sgRNA (F+E) with K09B11.2 U6 promoter and 3'UTR
UseCRISPRExpressionWormMutationF+E mutations in sgRNAAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pG3B-U6SC
Plasmid#134753PurposepGreen3 CRISPR/Cas9DepositorInsertCRISPR/Cas9
UseCRISPRPromotergRNA-U6, zCas9-35SCAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAH233
Plasmid#121144PurposeExpression of gRNA with BbsI placeholder for target cloningDepositorInsertgRNA cassette
UseCRISPRExpressionYeastPromoterS.pombe rrk1Available SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_1
Plasmid#86299PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
RFN_EGFP_47
Plasmid#60071PurposeExpresses a pair of control multiplex gRNAs targeting EGFP for use with dimeric hFokI-dCas9 nucleaseDepositorInsertpair of multiplex gRNAs targeting EGFP
UseCRISPRExpressionMammalianPromoterU6Available SinceOct. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
Fragment 1 Null
Plasmid#198729PurposeGateway-compatible gRNA backbone . Template for the addition of target sequences to produce 2x gRNA.DepositorInsertgRNA expression cassette in pENTR4
UseGateway CloningAvailable SinceMay 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3'UTR-Tetra-com-vector
Plasmid#132553PurposeExpresses spCas9 and sgRNA scaffold with com aptamer replacing the TetraloopDepositorInsertsCas9
sgRNA scaffold with com replacing the Tetraloop
ExpressionMammalianAvailable SinceMarch 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1P shNFS1_1
Plasmid#102963PurposeSuppression of NFS1DepositorInsertshNFS1_1 (NFS1 Human)
UseLentiviral and RNAiAvailable SinceNov. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
PTEN-mut (negative control)
Plasmid#86646Purposeexpression of control shRNADepositorInsertPTEN (control)
UseRNAiExpressionMammalianPromoterH1Available SinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD8A-iRGR-r11
Plasmid#74369PurposeThis plasmid constitutively expresses gRNA-r11 from an AHD1 promoter using the insulated RGR design. Integrates in the W303 HIS locus and restores HIS function.DepositorArticleInsertRGR-r11
UseCRISPR and Synthetic BiologyExpressionYeastPromoterAHD1Available SinceApril 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSPCas9(BB)-2A-GFP_ABCA3GFP_targeting
Plasmid#188541PurposePlasmid encoding pCas9 and gRNA targeting the endogenous human ABCA3 locus stop codonDepositorInsertgRNA
UseCRISPRTagsGFPPromoterU6Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_TEAD1_1
Plasmid#86356PurposeEncodes gRNA for 3' target of human TEAD1DepositorInsertgRNA against TEAD1 (TEAD1 Human)
UseCRISPRAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
px459 sgFIP200
Plasmid#175024PurposeCRISPR-Cas9 plasmid targeting exon 3 of human FIP200.DepositorInsertRB1CC1 (RB1CC1 Human)
ExpressionMammalianAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only