179,539 results
-
Plasmid#113624PurposesgRNA/CAS9 expression plasmid to induce the 3’ double-strand break in the EJ7-GFP reporterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert7b sgRNA
UseCRISPRExpressionMammalianAvailable sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
p3s-Sniper-Cas9
Plasmid#113912PurposeExpresses Sniper-Cas9 with CMV promoterDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSniper-Cas9
UseCRISPRExpressionMammalianPromoterCMVAvailable sinceAug. 8, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHR_PGK_antiHer24D5-8_synNotch_Gal4VP64
Plasmid#85425PurposeLentiviral vector for expression of anti-Her2 scFv 24D5-8 Gal4VP64 synthetic NotchDepositorInsertanti-Her2_4D5-8_synNotch
UseLentiviralPromoterPGKAvailable sinceJuly 31, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLJC6-2XFLAG-TMEM192
Plasmid#104435PurposeExpresses 2XFLAG-TMEM192 in mammalian cellsDepositorAvailable sinceJuly 2, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCMV_BE4max_3xHA
Plasmid#112096PurposeC:G-to-T:A base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBE4max_3xHA
UseCRISPRTags3xHAExpressionMammalianPromoterCMVAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pYLCRISPR/Cas9P35S-H
Plasmid#66189Purposeexpression of Cas9 in plants, cauliflower mosaic virus 35S promoter (P35S), hygro selectionDepositorInsertCas9
ExpressionPlantMutationplant-codon optimized with higher GC contents (62…Promotercauliflower mosaic virus 35S promoter (P35S)Available sinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) (AAV9)
Viral prep#100061-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) (#100061). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO C1V1 (t/t)-TS-mCherry (PV2670) plasmid DNA. EFIa-driven, Cre-dependent, C1V1 (t/t) fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Cre-dependent)Available sinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
FKBP-mCherry
Plasmid#108122PurposeRecruitable fluorophoreDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFKBP1A(isoform a, 3-108):mCherry (FKBP1A Human)
ExpressionMammalianPromoterCMVAvailable sinceApril 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-DIO ChETA-EYFP (AAV1)
Viral prep#26968-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-Ef1a-DIO ChETA-EYFP (#26968). In addition to the viral particles, you will also receive purified pAAV-Ef1a-DIO ChETA-EYFP plasmid DNA. EF1a-driven, Cre-dependent, ChETA fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available sinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pXN22-Dest
Plasmid#105085PurposeYeast mating-based Split Ubiquitin Assay, prey vector for Gateway cloningDepositorTypeEmpty backboneTagsNubG-3xHAExpressionYeastAvailable sinceFeb. 14, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
U6-sgRNA(MS2)_EF1a-MS2-P65-HSF1
Plasmid#92120PurposeExpression plasmid for both MS2-P65-HSF1 activator helper complex and sgRNA with two MS2 loops at tetraloop and stemloop 2 contains BsaI sites for insertion of spacer sequences.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMS2-P65-HSF1 (HSF1 Human, Synthetic)
UseCRISPRExpressionMammalianPromoterEF1aAvailable sinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
EB3-mScarlet-I
Plasmid#98826PurposeIn vivo visualization of microtuble plus ends (can be used for colocalization studies)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertEB3
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pJL 89
Plasmid#98558PurposeUseful for making infectious clones of RNA virus cDNAs; Has 35S promoter and HDV Ribozyme sequences in T-DNA region of Agrobacterium vector.DepositorTypeEmpty backboneExpressionPlantPromoterEnh 35SAvailable sinceAug. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
DNA-PKcs ABCDE>A
Plasmid#83318Purposehuman DNA-PKcs/ABCDE>alaDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman DNA-PKcs (PRKDC Human)
ExpressionMammalianMutation6 phosphorylation sites in the ABCDE cluster subs…Available sinceAug. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-TrxRFP1
Plasmid#98996Purposemammalian expression of a biosensor to monitor thioredoxin redox dynamicsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthuman thioredoxin 1, GS-rich linker, fused with a redox-sensitive RFP
TagsHis-tagExpressionMammalianPromoterCMVAvailable sinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMOD_C0000
Plasmid#91081PurposeModule C, Promoter: none, Gene: none (BaeI site for GT donor cloning), Terminator: noneDepositorTypeEmpty backboneUseUnspecifiedAvailable sinceJuly 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
7TFP CDH1 reporter
Plasmid#91704Purposelentiviral luciferase reporter containing CDH1 promoterDepositorInsertCDH1 promoter (CDH1 Human)
UseLentiviral and LuciferaseTagsluciferaseExpressionMammalianPromoterCDH1Available sinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pcDNA3-FLAG-mTET2
Plasmid#89735PurposeExpresses wildtype mouse TET2 in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertTET2 (Tet2 Mouse)
TagsFlagExpressionMammalianAvailable sinceMay 3, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDONR223_HSP90B1_WT
Plasmid#82130PurposeGateway Donor vector containing HSP90B1 , part of the Target Accelerator Plasmid Collection.DepositorAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
bZiPro
Plasmid#86846Purposeexpress NS2B-NS3 protease in E.coliDepositorPublicationInsertsNS3 1-177
NS2B45-96
Tagsa hexahistidine tag and a thrombin cleavage siteExpressionBacterialMutationNS2B cofactor region (residues 45–96) and NS3 pro…PromoterT7Available sinceMarch 2, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFA6a-HaloTag-KanMX6
Plasmid#87029PurposeTag S. pombe genes in C terminal with HaloTagDepositorInsertHaloTag
ExpressionBacterial and YeastAvailable sinceFeb. 23, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
miReporter-CAG
Plasmid#82478PurposemicroRNA reporter relying on a bidirectional CAG-based promoter. Contains MCS downstream of H2B-mCherry and H2B-Citrine to insert miRNA binding sites. Contains a Hygromycin selection cassette.DepositorInsertH2B-mCherry and H2B-Citrine. HygroR
Available sinceFeb. 14, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pY095
Plasmid#84744PurposeExpresses huLbCpf1-T2A-GFP and crRNA guideDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertshuLbCpf1
GFP
UseCRISPRTags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable sinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pP{ELAV-GeneSwitch}
Plasmid#83957PurposeExpresses conditional RU486-dependent GAL4 protein under control of the elav promotorDepositorInsertExpressionInsectPromoterelavAvailable sinceDec. 10, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Sg-A
Plasmid#83807PurposeExpress sgRNA targeting SA siteDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSgRNA
UseCRISPRAvailable sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Tol2 Gateway compatible toolbox for the study of the nervous system and neurodegenerative disease
Plasmid kit#1000000087PurposeA plasmid collection, based on the Tol2kit, used to streamline the production of transgenic zebrafish for studying neurodegenerative disorders.DepositorApplicationCloning and Synthetic BiologyVector typeZebrafish ExpressionCloning typeMultiSite GatewayAvailable sinceOct. 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
pME-loxP-mTagBFP2-stop-pA-loxP
Plasmid#75158PurposeFloxed TagBFP2 (blue) fluorophore with stop codon for inducible lines.DepositorPublicationInsertloxP-mTagBFP2-stop-pA-loxP
UseMiddle entry vector for multisite gateway three f…Promotern/aAvailable sinceOct. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV_Zika_NS4B_Flag
Plasmid#79640PurposeThird generation Self-inactivating lentivector expressing NS4B from Zika virusDepositorInsertNS4B
UseLentiviralTagsFlagExpressionMammalianPromoterEF1Available sinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-smURFP-T2A-mCardinal
Plasmid#80348PurposeLentiviral transfer vector under the CMV promoter that expresses smURFP and mCardinal.DepositorInsertssmURFP
mCardinal
UseLentiviralPromoterCMVAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pPICZalphaB-SapL3
Plasmid#78171PurposeExpression of Saporin L3 in pichiaDepositorInsertSaporin L3
Tagsalpha factorExpressionYeastAvailable sinceJuly 19, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSLC-217
Plasmid#73163PurposeTemplate plasmid which encodes a toxin gene (relE) under the control of rhamnose induceable promoter (PrhaB) to be used as a negative selection marker.DepositorAvailable sinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCTCON2 Aga2P-HRP
Plasmid#73152PurposeFull-length horseradish peroxidase (HRP) fused to the C-terminus of the yeast mating protein Aga2P. Galactose-inducible expression.DepositorInsertAga2P-HRP
TagsHA tag and myc tagExpressionYeastPromoterGAL1Available sinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
FAT FAK biosensor
Plasmid#78303PurposeFRET biosensor. Visualization of FAK activity at focal adhesions in live cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFAT FAK biosensor
ExpressionMammalianPromoterCMVAvailable sinceJune 13, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTKLP-tetA
Plasmid#71325PurposetetA landing pad template plasmidDepositorTypeEmpty backboneUseSynthetic BiologyExpressionBacterialAvailable sinceApril 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pKanCMV-mRuby3-18aa-actin
Plasmid#74255PurposeMammalian expression of N-terminal fusion of mRuby3 to actinDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertactin
TagsmRuby3ExpressionMammalianPromoterCAG and CMVAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pZ8-T_dCas9
Plasmid#74062PurposepZ8-1 plasmid carrying dcas9, driven by the IPTG-inducible Ptac promoter, KanRDepositorPublicationInsertdcas9
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterptacAvailable sinceApril 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDD315 (mTurquoise2^SEC^2xHA)
Plasmid#73343PurposemTurquoise2^SEC^2xHA vector with ccdB sites for cloning homology armsDepositorInsertmTurquoise2-C1^SEC^3xFlag
UseCRISPR and Cre/LoxTags2xHA and C. elegans codon-optimized mTurquoise2ExpressionWormAvailable sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMpGE010
Plasmid#71536PurposeFor CRISPR/Cas9 genome editing in Marchantia polymorphaDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceMarch 14, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET15b His6-FKBPF36V
Plasmid#73180PurposeExpressing FKBPF36V protein in washing out shield-1 ligand for FKBPddDepositorAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pET28-Dnmt3a3L-sc27
Plasmid#71827PurposeFor bacterial expression of Dnmt3a-Dnmt3L single-chain fusion protein protein. Contains the catalytic domain of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L connected by 27 aa linker.DepositorInsertDnmt3a catalytic domain (M. musculus) Dnmt3L (M. musculus) C-terminal domain gene fusion (Dnmt3a Mouse)
Tags6xHis tagExpressionBacterialAvailable sinceJan. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pFUGW-FerH-ffLuc2-eGFP
Plasmid#71393PurposeLentiviral vector of luciferase-eGFP fusion gene driven by FerH promoterDepositorInsertFerH-ffLuc2-eGFP
UseLentiviralExpressionMammalianPromoterFerHAvailable sinceDec. 9, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pERB264
Plasmid#67764PurposeTags peroxisomes with GFP and HalotagDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPEX3-GFP-Halo
TagsGFP and HalotagExpressionMammalianAvailable sinceNov. 3, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PM-FRB-CFP
Plasmid#67517PurposeFRB conjugated plasma membrane targeting sequences from GAP43 (MLCCMRRTKQVEKNDDQKI)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmTOR (MTOR Human)
TagsCFP, HA, and PM tethering sequence (MLCCMRRTKQVEK…ExpressionMammalianMutationFRB domain only (residues 2019–2114)PromoterCMVAvailable sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pDestattB (pCM268)
Plasmid#68313PurposeMultisite Gateway destination vector to create transgenes for phiC31-mediated transgenesis in zebrafishDepositorTypeEmpty backboneUseZebrafish transgenesisAvailable sinceAug. 20, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMB1610_pRR-Puro
Plasmid#65853PurposePuromycin-based homologous recombination-dependent reporter for genome editing with TALENs or CRISPR/Cas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsplit puromycin N-acetyltransferase coding sequence
UseCRISPR and TALENExpressionMammalianPromoterSV40Available sinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pCSF107mT-GATEWAY-3'-Myc tag
Plasmid#67617PurposeA pCS2 based vector to generate a 3'-Myc tag using GATEWAY cloning technologyDepositorTypeEmpty backboneUseIn vitro transcription or translation off of an s…TagsC-terminal MycExpressionMammalianPromoterCMV and SP6Available sinceAug. 4, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-EF1a-tdTomato-WPRE-pGHpA
Plasmid#67527Purpose"Expresses the fluorescent protein tdTomato"DepositorInserttandem dimer tomato
UseAAVExpressionMammalianPromoterEF1aAvailable sinceJuly 23, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOPINB-AMSH*
Plasmid#66712PurposeExpresses activated AMSH in E. coliDepositorAvailable sinceJuly 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pEYFP-Sec31A
Plasmid#66613PurposeYFP fusion of Sec31ADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSec31A (SEC31A Human)
TagsEYFPExpressionMammalianAvailable sinceJuly 8, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by