We narrowed to 23,099 results for: crispr
-
Plasmid#132412Purposeoverexpression in human cellsDepositorInsertdAdmCas13b
UseLentiviralTagsflagExpressionMammalianMutationR269A; H274A; R837A; H842APromoterAvailable SinceApril 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG MCP-VP64
Plasmid#92357PurposeCAG-driven ubiquitous expression of MCP-VP64. MCP is bacteriophage MS2 coat protein, VP64 is transcriptional activation domain. Part of SAM-mediated gene activation system in chicken embryos.DepositorInsertMCP-VP64
UseCRISPRTagsExpressionMammalianMutationPromoterCAGAvailable SinceAug. 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-NORAD
Plasmid#196086PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting lncRNA NORAD.DepositorInsertgRNA targeting lncRNA NORAD
UseCRISPRTagsExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…PromoterAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJY-RpABE-PDS3_IMS
Plasmid#112875Purposebinary vector for IMS (Induced Mis-Splicing) of PDS3 in ArabidopsisDepositorInsertsRPS5A promoter
ABE7.10
U6-sgRNA targeting PDS3
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-Universal.Sth.dCas9
Plasmid#171088PurposeCRISPR interference. Recipient construct for cloning 20-nt spacers into the sgRNA scaffold compatible with Streptococcus thermophilus dCas9 (CRISPR1 system) via BsaI restriction sites.DepositorInsertsToxoplasma U6 upstream region – spacer cloning site - sgRNA scaffold (compatible with S. thermophilus Cas9 CRISPR1)
DHFR-TSc3
UseToxoplasma gondii expressionTagsExpressionMutationNote: A S245F mutation is present but did not app…PromoterDHFR-TS (Toxoplasma gondii) and U6 (Toxoplasma go…Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mScarlet-H2BC11
Plasmid#207756PurposeDonor template for mScarlet insertion into the C-terminus of the H2BC11 locus for nuclei visualization. To be co-transfected with sgRNA plasmid px330-PITCh-H2BC11 Addgene #207755DepositorInsertH2BC11 Homology Arms flanking a mScarlet Tag (H2BC11 Human)
UseCRISPR; Donor templateTagsExpressionMammalianMutationPromoterAvailable SinceNov. 16, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
gh39
Plasmid#106713Purposeexpression of gRNA targeting STT3BDepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
B270 + SPRTN sgSTOP
Plasmid#100718PurposeB270 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) in combination with ATP1A1 sgSTOPDepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRTagsExpressionMammalianMutationPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPV-H1-ccdB-mEF1α-RiH
Plasmid#100598PurposepiggyBac vector for sgRNA cloningDepositorTypeEmpty backboneUsePiggybac vectorTagsExpressionMammalianMutationPromoterHuman H1 PolIII promoter, human FTH1 promoter, mo…Available SinceApril 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAC84-pCR8-dCas9
Plasmid#48218PurposedCas9 on Gateway donor vector pCR8/GW/TOPO. Note: This is not for expression. It has to be transferred to a gateway destination vector for expressionDepositorInsertdCas9(D10A;H840A)
UseCRISPR; Gateway donorTagsHA TagExpressionMutationD10A;H840APromoterAvailable SinceSept. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
p1194-scAAV-U6-sgRNA_Nme2Cas9_Rosa26-CB-PI-AcrIIA4_FLAG_NLS
Plasmid#129532PurposeSelf-complementary AAV vector expressing Nme2Cas9 sgRNA targeting Rosa26 and AcrIIA4DepositorInsertscodon-optimized AcrIIA4
sgRNA_Rosa26
UseAAVTagsFLAG/NLSExpressionMutationPromoterU6 and cytomegalovirus-enhancer chicken β-actin p…Available SinceSept. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
G1333 DddAtox-N–dSpCas9
Plasmid#157833Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLS–G1333 DddAtox-N–dSpCas9–UGI–UGI–bpNLS
UseTagsExpressionMammalianMutationPromoterAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CEBPA
Plasmid#86293PurposeDonor vector for 3' FLAG tag of human CEBPADepositorInsertCEBPA homology arms (CEBPA Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceAug. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_ELAVL1
Plasmid#106106PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting ELAVL1DepositorAvailable SinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
tdTomato/pTREX-b
Plasmid#68709PurposeExpresses tdTomato in pTREX-b vector which confers resistance to blasticidin. This vector is used for cloning a specific sgRNA by BamHI, to transfect Cas9-expressing Trypanosoma cruzi epimastigotes.DepositorInserttdTomato
UseExpression of tdtomato red fluorescence protein i…TagsExpressionMutationPromoterAvailable SinceOct. 8, 2015AvailabilityIndustry, Academic Institutions, and Nonprofits -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pM124: pAAV-EFS-CasRx-VEGFA presgRNA
Plasmid#166872PurposeAAV vector for expressing CasRx and human VEGFA targeting presgRNA for RNA-editingDepositorInsertsU6-VEGFA presgRNA
RfxCas13d
UseAAV and CRISPRTagsHA and NLSExpressionMammalianMutationPromoterEFS and U6Available SinceJuly 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRTagsExpressionMutationPromoterAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hASCL1 gRNA_multi1-3-MS2-Puro
Plasmid#192682PurposeLentiviral expression of multi gRNAs targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNAs #1,2,3 (ASCL1 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRTagsExpressionMutationPromoterAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-A10
Plasmid#196085PurposeInducible CRISPRi vector conferring puromycin resistance, expressing gRNA targeting mouse Adam10.DepositorInsertgRNA targeting Adam10
UseCRISPRTagsExpressionMammalianMutationCloned using SapI sites - destroyed after inserti…PromoterAvailable SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLPB2-SpdCas9-tagRFPt-P2A-tagBFP-PGK-Blasticidin
Plasmid#187945PurposedCas9 fused with tagRFPt, P2A site and tagBFP, expressed under EF1-alpha promoter in a piggyBac plasmid. Expresses Blasticidin resistance under PGK promoter.DepositorInsertSpdCas9-tagRFPt-P2A-tagBFP
UseSynthetic Biology; PiggybacTagsNLS, NLS + HA-tag, P2A, tagBFP, and tagRFPtExpressionMammalianMutationPromoterAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_ARID5B
Plasmid#86288PurposeDonor vector for 3' FLAG tag of human ARID5BDepositorInsertARID5B homology arms (ARID5B Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_MIER3
Plasmid#86274PurposeDonor vector for 3' FLAG tag of human MIER3DepositorInsertMIER3 homology arms (MIER3 Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC518
Plasmid#62277PurposeYeast dCas9 expression plasmidDepositorInsertdCas9
UseTagsExpressionYeastMutationHas mutations in the RuvC1 and HNH domains to ren…PromoterpTdh3Available SinceMarch 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-ctrl-guides
Plasmid#168240Purpose"neutrophil specific GFP with ubiquitous ctrl sgRNAs"DepositorInsertcontrol sgRNAs
UseCRISPRTagsExpressionMutationPromoterAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMS18: pHelper(PmcCAST)_PmcPSP1
Plasmid#168151PurposeInducible expression of PmcCAST proteins with crRNA targeting PmcPSP1.DepositorInsertsPmcCAST minimal CRISPR array (with spacer for PmcPSP1)
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB, TnsC and TnsD)
PmcTniQ
UseTagsExpressionBacterialMutationPromoterAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
MSP2279
Plasmid#70706PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 2: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #2DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A and H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC519
Plasmid#62278PurposeYeast dCas9-VP64 expression plasmidDepositorInsertdCas9-VP64
UseTagsHas a VP64 fusionExpressionYeastMutationHas mutations in the RuvC1 and HNH domains to ren…PromoterpTdh3Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pMS23: pHelper(PmcCAST)_entry_ΔTnsD
Plasmid#168156PurposeInducible expression of PmcCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB and TnsC)
PmcTniQ
UseTagsExpressionBacterialMutationPromoterAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_FOXP1
Plasmid#86261PurposeDonor vector for 3' FLAG tag of human FOXP1DepositorInsertFOXP1 homology arms (FOXP1 Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceFeb. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI009-pKW20088-PelcA-mCherry-TtrpC-NotI-PacI
Plasmid#140202PurposeCRISPRa proof-of-concept test target with fluorescent reporter. PelcA is fused to mCherry, with low basal expression in Aspergillus nidulans. Fungal vector with AMA1 and pyrG selection marker.DepositorInsertmCherry
UseCRISPR and Synthetic Biology; Proof-of-concept te…TagsExpressionMutationG174DPromoterPelcAAvailable SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUbi-RZ-Aac
Plasmid#129685Purpose(Empty backbone) Gateway entry clone with sgRNA under ZmUbi promoterDepositorInsertEmpty backbone
UseCRISPRTagsExpressionPlantMutationPromoterAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KAT7
Plasmid#86266PurposeDonor vector for 3' FLAG tag of human KAT7DepositorAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
gh53
Plasmid#106726Purposeexpression of gRNA targeting ST3GAL5DepositorAvailable SinceNov. 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMS3: pHelper(AvCAST)_AvPSP1_ΔTnsD
Plasmid#168135PurposeInducible expression of AvCAST proteins (except TnsD) with crRNA targeting AvPSP1.DepositorInsertsAvCAST minimal CRISPR array (with spacer for AvPSP1)
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
UseTagsExpressionBacterialMutationPromoterAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS21: pHelper(PmcCAST)_entry
Plasmid#168154PurposeInducible expression of PmcCAST proteins. Two BsaI sites for spacer cloning.DepositorInsertsPmcCAST minimal CRISPR array
PmcCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
PmcCAST Tns proteins (TnsAB, TnsC and TnsD)
PmcTniQ
UseTagsExpressionBacterialMutationPromoterAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDECKO-mCherry MALAT1_Enhancer.1
Plasmid#78536PurposeExperimental plasmidDepositorInsertgRNA1+scaffold+H1promoter+gRNA2
UseLentiviralTagsExpressionMammalianMutationPromoterU6 (for expressing sgRNA) and U6 promoterAvailable SinceSept. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRTagsExpressionBacterialMutationPromoterAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_KDM6A
Plasmid#86265PurposeDonor vector for 3' FLAG tag of human KDM6ADepositorInsertKDM6A homology arms (KDM6A Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceJan. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSHS325 - Bacterial expression plasmid for SpCas9 REC3 domain
Plasmid#101205PurposeBacterial expression plasmid for SpCas9 REC3 domainDepositorInsertSpCas9 variant K506–Q712
UseTags10x His, MBP, and TEV siteExpressionBacterialMutationK506–Q712PromoterT7Available SinceNov. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC027 - LweCas13a from Listeria weihenstephanensis FSL R9-0317
Plasmid#91917PurposeExpresses LweCas13a for bacterial expression and contains backbone for spacer cloningDepositorInsertLweCas13a and guide expression cassette
UseTagsExpressionBacterialMutationPromoterAvailable SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC595
Plasmid#62322PurposeExpresses MCP-VP64 and dCas9 in Yeast cellsDepositorInsertsMCP-VP64
dCas9
UseTagsVP64ExpressionYeastMutationHas nuclease-inactivating mutations in the RuvC1 …PromoterTdh3 and pAdhAvailable SinceMarch 23, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFETCh_CEBPG
Plasmid#86285PurposeDonor vector for 3' FLAG tag of human CEBPGDepositorInsertCEBPG homology arms (CEBPG Human)
UseCRISPRTags3XFLAG-P2A-NeoRExpressionMutationPromoterAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRI008-PgpdA-Cas12aScaffold-BsmbI-Cas12aScaffold-TrcpT
Plasmid#140201PurposeFungal vector for one-step cloning of LbCas12a crRNA arrays and expression. Pgpda and pyroA are BsmbI domesticated.DepositorTypeEmpty backboneUseCRISPR and Synthetic Biology; Cloning of crrna an…TagsdLbCas12a crRNA scaffoldExpressionMutationPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDIV494
Plasmid#177701PurposePlasmid expressing optimized Cas9 and NAT marker and sgRNA targeting ADE2 locus in D. hanseniiDepositorInsertsCas9
Nat
sgRNA Targeting ADE2 locus in D.hansenii: AGCTAAGCAGATTAATGCAT
UseCRISPRTagsSV40ExpressionBacterial and YeastMutationPromoterRNR2p (Debaryomyces hansenii ), SNR52p (Candida s…Available SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMS6: pHelper(AvCAST)_entry_ΔTnsD
Plasmid#168139PurposeInducible expression of AvCAST proteins (except TnsD). Two BsaI sites for spacer cloning.DepositorInsertsAvCAST minimal CRISPR array
AvCAST Cascade proteins (Cas6, Cas8, Cas7 and Cas5)
AvCAST Tns proteins (TnsA, TnsB, TnsC and TniQ)
UseTagsExpressionBacterialMutationPromoterAvailable SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only