We narrowed to 8,876 results for: sgrna
-
Plasmid#133348Purposeexpression of two sgRNA from Streptococcus thermophilus #3 each express from its own constitutive promoter; here first one targets blaA and second one targets cpaA (from Caulobacter crescentus)DepositorInsertsgRNA_blaA and sgRNA_cpaA
UseCRISPRPromoterconstitutiveAvailable SinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSGKP_AcsgRNA
Plasmid#203807PurposepSGKP-based plasmid containing a J23119-driven sgRNA cassette, with replaceable spacer (BsaI-restriction sites). Kanamycin resistance.DepositorInsertAcgRNA
UseCRISPRPromoterJ23119Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
px330_Rosa_sgRNA
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
psgRNA
Plasmid#114005Purposeexpress sgRNA. ColE1, KanDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
U6>sgRNA(F+E)
Plasmid#59986PurposeEmpty vector for sgRNA cloning (F+E modified backbone)DepositorTypeEmpty backboneUseCRISPRPromoterCiinte.U6Available SinceNov. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
pHelper_ShCAST_sgRNA
Plasmid#127921PurposeExpresses ShCAST and an empty sgRNA scaffold. New targets can be added using Golden Gate assembly (LguI sites).DepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning (LguI sites)
Available SinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
psgRNAc
Plasmid#114006Purposeexpress sgRNA, p15A, CRMDepositorInsertgRNA
PromoterBBa_J23119Available SinceFeb. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330_PHF19_sgRNA
Plasmid#246404PurposeCas9/sgRNA expression plasmid targeting PHF19DepositorInsertPHF19 (PHF19 Human)
ExpressionMammalianAvailable SinceNov. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pnsgRNA
Plasmid#172717PurposeDelivery of guide RNA for prime editingDepositorInsertJ23119-gRNA
ExpressionBacterialAvailable SinceSept. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
sgRNA_expression_vector
Plasmid#210212PurposeAn empty gRNA expression vector to clone U6 promoter driven sgRNAs with gRNA scaffold and with co-expression of DsRed. sgRNA can be cloned by Golden Gate Assembly or restriction digestion using BbsI.DepositorTypeEmpty backboneExpressionBacterial and MammalianPromoterU6Available SinceDec. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCgsgRNA_crtYf
Plasmid#153338PurposeDouble-plasmid-based CRISPR-Cas9 system in Corynebacterium glutamicum; rep oriVC. glutamicum; pMB1 oriVE. Coli; Pj23119-crRNA targeting crtYf; SpcrDepositorInsertcrRNA targeting crtYf
UseCRISPRExpressionBacterialAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-NT
Plasmid#89960PurposeContains arabinose-induced lambda Red and a tet-inducible non-targeting gRNA containing BsmBI sites for cloning.DepositorInsertempty gRNA
ExpressionBacterialPromoterpTetAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
EC2_10_dCas9_VPR_HC_sgRNA
Plasmid#163712PurposeYeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domainsDepositorInsertsdCas9
VPR
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_LTN1
Plasmid#127125DepositorInsertgRNA LTN1 (LTN1 Human)
UseCRISPRAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
NmCas9_sgRNA_expression_in_pBluescript
Plasmid#122091PurposeU6 driven NmCas9 sgRNA expression vector for cloning own guidesDepositorInsertNmCas9 tracrRNA (NEWENTRY Synthetic, S. pyogenes)
UseCRISPRExpressionMammalianPromoterU6Available SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pGH224_sgRNA_2xMS2_Puro
Plasmid#85413PurposehU6 driven sgRNA vector with 2xMS2 vectors with puro selectable markerDepositorInsertpuromycin resistance
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tRFP
Plasmid#169941PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tRFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
PtPuc3_diaCas9_sgRNA
Plasmid#109219PurposeEpisome based vector with CRISPR/Cas9_sgRNA module for genome editing in Phaeodactylum tricornutumDepositorInsertsLHCF2 promoter
diaCas9
LHCF1 terminator
U6 promoter
sgRNA
U6 3' region
UseCRISPR and Synthetic BiologyPromoterLHCF1 terminator, LHCF2 promoter, U6 3' regi…Available SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_pos6_AmpR
Plasmid#119149PurposeEncodes sgRNA targeting position 6 in pColE1_70a_deGFP_KanRDepositorInsertsgRNA targeting position 6 in pColE1_70a_deGFP_KanR
UseCrisprAvailable SinceNov. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
LCV2_LacZ_sgRNA_2
Plasmid#155093Purposelentiviral plasmid expressing Cas9 and gRNA targeting LacZDepositorInsertLacZ_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCnCas12f1HS_sgRNA_MS13_empty
Plasmid#204999PurposeCnCas12f1 with MS13 sgRNA site for Human cell genome editingDepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
esgRNA_NbPDS
Plasmid#231147PurposeT-DNA encoding TRV2 with mobile gRNA targeting NbPDSDepositorInsertmobile gRNA targeting NbPDS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
EC2_1_dCas9_sgRNA
Plasmid#163710PurposeYeast low copy plasmid with dCas9 and sgRNA expression cassetteDepositorInsertdCas9
ExpressionYeastMutationPoint mutations D10A and H840APromoterScTEF1Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459_MCM2_sgRNA
Plasmid#232730PurposeGenerates MCM2 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459_CDC45_sgRNA
Plasmid#232732PurposeGenerates CDC45 dTAG C ternimal knock-in cell linesDepositorAvailable SinceMarch 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
LCV2_AAVS1_sgRNA_2
Plasmid#155088Purposelentiviral plasmid expressing Cas9 and gRNA targeting AAVS1 safe harbor locusDepositorInsertAAVS1_sgRNA_2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 promoterAvailable SinceAug. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pColE1_sgRNA_NT_AmpR
Plasmid#119144PurposeEncodes non-targeting sgRNADepositorInsertnon-targeting sgRNA
UseCrisprAvailable SinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
SaCas9_sgRNA_expression_in_pBluescript
Plasmid#122090PurposeU6 driven SaCas9 sgRNA expression vector for cloning own guidesDepositorAvailable SinceApril 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
sgRNA.SFFV.tBFP
Plasmid#169940PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and tBFP from SFFV promoter as the marker for infection. 3rd generation lentiviral backbone.DepositorTypeEmpty backboneUseLentiviralAvailable SinceJuly 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
px458_2A_GFP_sgRNA_TIA1
Plasmid#106097PurposeCRISPR knockout. Expresses Cas9, EGFP, and sgRNA targeting TIA1DepositorInsertgRNA TIA1
UseCRISPRAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_sgRNA
Plasmid#100554PurposeExpresses AAVS1 sgRNA. Target sequence: GGGGCCACTAGGGACAGGATDepositorInsertAAVS1 sgRNA
PromoterU6Available SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
p206_LTJ_sgRNACD45.2_R3
Plasmid#82674PurposesgRNA targeting murine CD45.2 region 3. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting CD45.2 region 3
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Nme2sgRNA_pLKO
Plasmid#119926PurposeNme2Cas9 U6-driven sgRNA cassetteDepositorInsertNmeCas9 sgRNA
UseLentiviralExpressionMammalianPromoterU6Available SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only