We narrowed to 9,360 results for: CAG
-
Plasmid#104819PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-2). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN155
Plasmid#91684PurposeExpress sgRNA targeting human ZNF536DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7 probasin_mTQ2_FlpO
Plasmid#68356Purpose-The prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and SMAD4 ex2. are expressed by the U6 promoterDepositorInserts4xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterSynthetic Probasin ARRx2 and U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
-
-
pSB700
Plasmid#64046PurposeLentiviral vector for expressing U6 sgRNA and CAGGS Cerulean fluorescent proteinDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterU6, CAGGSAvailable SinceMay 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSC50
Plasmid#104824PurposeCRISPR/Cas9 2xplex gRNA targeting Glyma.08g081600, Glyma.05g126600 (Hen1ab). Also expresses Cas9 from Gmubi promoter.DepositorInsertGlyma.08g081600, Glyma.05g126600
UseCRISPRExpressionPlantAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_Dual_sgRNA
Plasmid#178104PurposeCoselection for PE3 in human cells. Vector for tandem expression of ATP1A1 G8 sgRNA with a user-specified PE3 nick sgRNA from two independent U6 promoters. Cloning of oligos using BbsI sites.DepositorInsertATP1A1 G8 sgRNA + user-specified sgRNA
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-MC38-TCRB-32-riot_punisher
Plasmid#138988PurposeIVT template for the beta subunit of the mouse TCR #32 that is reactive against MC38DepositorAvailable SinceMarch 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shRFP
Plasmid#110940PurposeTet-inducible shRNA targeting RFPDepositorInsertshRFP
UseLentiviral and RNAiPromoterH1/TOAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
tet_pLKO.1_puro_shLuc
Plasmid#136587PurposeExpresses an inducible short hairpin targeting firefly luciferase sequenceDepositorInsertshLuc
UseLentiviralExpressionMammalianAvailable SinceJune 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-GSK3β-#1
Plasmid#32496DepositorAvailable SinceSept. 26, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL1M-pMtRC-MtLAP1-Adh-R1
Plasmid#170790PurposeA Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic StudiesDepositorInsertMtLAP1 (LOC11412013 Medicago truncatula)
ExpressionBacterial and PlantPromoterMedtr4g059670(MtRC)Available SinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1 sgTollip
Plasmid#196546PurposeLentiviral CRISPR-Cas9 plasmid containing gRNA targeting exon 1 of human Tollip. Used for generation of Tollip protein knockouts in human cell lines.DepositorAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pmCherry-C1-FAK-HA-V744G
Plasmid#35040DepositorInsertfocal adhesion kinase (Ptk2 Mouse)
Tags2x HA and mCherryExpressionMammalianMutationGFP-FAK-V744G was generated from GFP-FAK using th…Available SinceMarch 8, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22
Plasmid#22117DepositorAvailable SinceNov. 17, 2009AvailabilityAcademic Institutions and Nonprofits only -
pW193-lenti-sasgRNA-lacZ-pEF1s-NLS-mNeonGreen-P2A-BlastR
Plasmid#170814PurposeLentiviral vector to co-express a lacZ control sasgRNA with NLS-mNeonGreenDepositorInsertNLS-mNeonGreen-P2A-BlastR
UseLentiviralExpressionMammalianMutationNAAvailable SinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
lenti-EGFR-T790M-tmpknot-epegRNA
Plasmid#214093PurposeLentiviral vector expressing epegRNA to induce EGFR T790M mutationDepositorInsertEGFR T790M epegRNA
UseLentiviralExpressionMammalianPromoterhU6Available SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PBLO CasX-gRNA
Plasmid#126419PurposeE. coli vector for CasX gRNA --- Used for In Vitro TranscriptionDepositorInsertcasX gRNA
UseCRISPR; In vitro transcriptionAvailable SinceJune 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-mCherry
Plasmid#75132PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-ctrl-guides
Plasmid#168240Purpose"neutrophil specific GFP with ubiquitous ctrl sgRNAs"DepositorInsertcontrol sgRNAs
UseCRISPRAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
1375_pAAV-U6-SA-WTmLdlrEx14-gRNA2-N22-CB-SACas9-HA-OLLAS-spA
Plasmid#109311PurposePlasmid for AAV SaCas9 Mammalian Expression with a gRNA against LdlrDepositorInsertLdlr gRNA
UseAAV and CRISPRExpressionMammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
MSCV-miR30_shBrd9_1061-PGK-NeoR-IRES-GFP
Plasmid#75129PurposeRetroviral expression plasmid encoding shBrd9_1061 (targeting murine Brd9)DepositorInsertshBrd9_1061
UseRetroviralAvailable SinceMay 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
JPF0419d
Plasmid#124020PurposeEncodes pCAG driving expression of multicistronic Lyn-tagged iRFP713, cytoplasmic mAzamiGreen, mCerulean-tethered p38 KTR, and Histone 2B fused to mScarlet in a PiggyBac destination vectorDepositorInsertPB_pCAG-Lyn-iRFP713-P2A-NES-mAzamiGreen-P2A-p38KTR-mCerulean-P2A-H2B::mScarlet
ExpressionMammalianAvailable SinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-blast shGAC
Plasmid#110410PurposeshGAC (Target CCTCTGTTCTGTCAGAGTT), silence glutaminase isoform GAC, blasticidin selection.DepositorInsertGLS glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR/U6 HDAC5 shRNA
Plasmid#32222DepositorAvailable SinceSept. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2827 pHR: U6-SpsgSV40 CMV-PYL1-KRAB-IRES-mCherry
Plasmid#84260PurposeExpresses Sp sgSV40 gRNA with ABA-inducible KRAB and mCherry for diametric regulationDepositorInsertsSp sgSV40
PYL1-KRAB
UseCRISPR and LentiviralTagsIRES-mCherry and PYL1ExpressionMammalianPromoterCMV and mouse U6Available SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
SMC3 A8.4 gRNA
Plasmid#90897Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation A8.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
SMC3 H8.1 gRNA
Plasmid#90895Purpose3rd generation lentiviral gRNA plasmid targeting human SMC3DepositorInsertSMC3 (Guide Designation H8.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22-C14A
Plasmid#22113DepositorAvailable SinceSept. 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
HSF1 KO
Plasmid#200207PurposegRNA for HSF1 KODepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-GFP-U6ac-cdk2-guides
Plasmid#168250Purpose"neutrophil specific GFP with ubiquitous cdk2 sgRNAs"DepositorInsertcdk2 sgRNAs
UseCRISPRAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9 probasin_mTQ2_FlpO
Plasmid#68357PurposeThe prostate specific promoter controls expression of FlpO linked to a blue flourescent protein. gRNA towards PTEN ex5, p53 ex7 and 8, and SMAD4 ex2 and ex 9 are expressed by the U6 promoter.DepositorInserts5xgRNA: PTEN exon 5, p53 exon 8, SMAD4 exon 2, p53 exon 7, SMAD4 exon 9
FlpO recombinase
UseCRISPRTagsmTurquoise2 (BFP)ExpressionMammalianPromoterU6 and synthetic Probasin ARRx2Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
AAV.CBA.YFP.miR-E_shStk16-1
Plasmid#180391PurposeProducing AAV that encodes mouse Stk16 shRNA-1 with miR-E backboneDepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
CENPF C5.1 gRNA
Plasmid#90616Purpose3rd generation lentiviral gRNA plasmid targeting human CENPFDepositorInsertCENPF (Guide Designation C5.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSC43
Plasmid#104817PurposeCRISPR/Cas9 1xplex gRNA targeting Glyma.04g057400 (Dcl3a-1). Also expresses Cas9 from Gmubi promoter from rolD promoterDepositorInsertGlyma.04g057400
UseCRISPRExpressionPlantAvailable SinceFeb. 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJG488
Plasmid#91196PurposeWDV replicon T-DNA for gene targeting in wheat scutella, H840A double nickase (nTaCas9_H840A+gUbi8+gUbi1+donor)DepositorInsertnTaCas9_H840A+gUbi8+gUbi1+donor
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLG1-puro-sgATL3-2
Plasmid#109010PurposeCRISPRi knockdown of targeted gene (to be used with Addgene #102244 or other dCas9-KRAB constructs)DepositorAvailable SinceAug. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgHAL
Plasmid#102315Purposegenetic depletion of HALDepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Myocardin
Plasmid#100769PurposeLentiviral expression of shRNA targeting MYOCDDepositorInsertLenti-sh-Myocardin
UseLentiviralExpressionMammalianPromoterhU6Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P1-Ataxin3Q22-UIM*
Plasmid#22114DepositorAvailable SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only -
WPXL LEFTY2 gRNA
Plasmid#101924PurposeLEFTY2 gRNA used for targeted demethylation is inserted into the WPXL lentiviral backbone.DepositorInsertLEFTY2 enhancer targeting gRNA
UseLentiviralAvailable SinceDec. 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
NDC80 F11.1 gRNA
Plasmid#90786Purpose3rd generation lentiviral gRNA plasmid targeting human NDC80DepositorInsertNDC80 (Guide Designation F11.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUDP010
Plasmid#101166PurposeE. coli/S. cerevisiae amdS shuttle vector expressing a ribozyme flanked g-RNA for Cas9 editing targeting the gene SeILV6 in S. pastorianus (HH-gRNASeILV6-HDV)DepositorInsertHH-gRNA-HDV targetting SeILV6 in S. pastorianus
UseCRISPRExpressionYeastPromoterScTDH3Available SinceDec. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-UBF
Plasmid#247350PurposeExpresses SpCas9 and a sgRNA targeting the human UBF loci for knock-in.DepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only