We narrowed to 24,790 results for: Spr
-
Plasmid#176678PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EBFP2-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only
-
pJMP1333
Plasmid#119268Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
p1071-Lenti-Single loxP
Plasmid#217892PurposeLentiviral vector, entry vector for Lentiviral Switch-OVERDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-IRES-puro-NLS-NLS-dPba3Cas13b-3xGFP-NLS
Plasmid#191369PurposeOverexpression of NLS-NLS-dPba3Cas13b-3xGFP-NLS in human cellsDepositorInsertNLS-NLS-dPba3Cas13b-3xGFP-NLS
Tags3xGFPExpressionMammalianAvailable SinceOct. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
STAgR_tdTomato
Plasmid#102993PurposeCan be used as backbone for a STAgR reactionDepositorTypeEmpty backboneUseCRISPR; Pcr template for stagr vectorsPromoterU6Available SinceMarch 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
BPK1179
Plasmid#179296PurposeExpresses dCas9 fused to four DmrA domainsDepositorInsertdCas9-DmrA(x4)
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU6_(GLuc)_INT[3xPP7_SL]
Plasmid#68424PurposeTransient expression of an "INT" construct_bearing three PP7 Stem-loops, targeting the GLuc reporter, in mammalian cells. U6 promoterDepositorInsertINT construct bearing three PP7 Stem-loops
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterhuman U6Available SinceOct. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA4
Plasmid#136662PurposeExpresses human codon-optimized AcrIIA4 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA4
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRB17
Plasmid#52527Purposeserves as template for PCR-mediated fusion of U6-promoter with sgRNADepositorInsertDrosophila U6C promoter
UseCRISPR; Blunt cloning kitTagsT7-promoterExpressionInsectAvailable SinceApril 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVG1
Plasmid#111444PurposeUnified Solo vector pV1382 + sgScADE2 + ScADE2 stop codon repair tempateDepositorInsertCaCas9/sgScADE2/stop-codon repair
UseCRISPRExpressionYeastAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pHAGE-IRES-puro-NLS-NLS-dHgm4Cas13b-3xGFP-NLS
Plasmid#191368PurposeOverexpression of NLS-NLS-dHgm4Cas13b-3xGFP-NLS in human cellsDepositorInsertNLS-NLS-dHgm4Cas13b-3xGFP-NLS
Tags3xGFPExpressionMammalianAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aalb_743
Plasmid#176662PurposeExpression of sgRNA under Ae. albopictus U6 (AALF029743) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCH62 (denAsCas12a-KRAB piggyBac)
Plasmid#217333PurposepiggyBac expression of denAsCas12a-KRABDepositorInsertdenAsCas12a
UseCRISPRTags6xMycNLS and HA-SV40NLS-XTEN80-KRAB-P2A-TagBFP2ExpressionMammalianMutationD908A/E174R/S542R/K548RPromoterCAGAvailable SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ230-E795L
Plasmid#176890PurposeGateway entry plasmid (attL1 & attR5) expressing LbCas12a with E795L mutation, without promoterDepositorInsertLbCas12a-E795L
UseCRISPR; Gateway compatible lbcpf1 entry cloneTagsNucleoplasmin NLS and SV40 NLSExpressionPlantAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJRH056
Plasmid#171637PurposePlasmid containing a U6 promoter expressing a spyCas9 tdTom sgRNA298 and CAG promoter expressing mTagBFP2DepositorInsertsspyCas9 sgRNA-tdTomato
mTagBFP2
UseCRISPR and LentiviralExpressionMammalianPromoterCAG and U6Available SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHAGE-BFP
Plasmid#106282PurposeA version of the pHAGE vector with BFP and dsRed expressed separated by an IRES. Note that dsRed is not expressed.DepositorInsertCMV-BFP-IRES-DSRED(NOT-EXPRESSED)-WPRE-MCS
UseCRISPR and LentiviralExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRW004-SM-destination-proUBQ10-Cas9
Plasmid#104438PurposeDestination vector expressing plant-codon-optimized Cas9 under UBQ10 promoter, with sgRNAs be shuffled in; seed coat specific red fluorescence for screening trangene free plants;DepositorTypeEmpty backboneUseCRISPRExpressionBacterial and PlantPromoterUBQ10Available SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-RRBP1-2
Plasmid#92157PurposeCRISPR guide RNA targeting human RRBP1DepositorInsertRRBP1 sgRNA-2
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceSept. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiU6-hMYOD1 gRNA_1-MS2-Puro
Plasmid#192673PurposeLentiviral expression of sgRNA targeting hMYOD1 promoter to activate human MYOD1 transcriptionDepositorInsertHuman MYOD1 activating gRNA #1 (MYOD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFH6
Plasmid#86555PurposeSubcloning of any sgRNA via BbsI sites. Note that there is an improved version of this plasmid (Addgene 105866) that results in up to 10x greater efficiencyDepositorInsertU6-26p::sgRNA scaffold
UseCRISPR; SubcloningPromoterArabidopsis U6-26 promoterAvailable SinceMay 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC-hU6-crScaffold_SV40-BFP
Plasmid#224860PurposecrRNA scaffold for RfxCas13d expressed from hU6 promoter and reporter BFP protein expressed from SV40 promoterDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionMammalianPromoterhU6Available SinceOct. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF005-sgRNA-shuffle-in
Plasmid#104441PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF004.DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRExpressionBacterial and PlantAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgSlc17a8
Plasmid#124861PurposeMutagenesis of Slc17a8DepositorInsertSlc17a8 (Slc17a8 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pVAX_CBI_AcrIIA2
Plasmid#136661PurposeExpresses human codon-optimized AcrIIA2 in mammalian cells. ORF flanked by NotI and XhoI restriction sitesDepositorInsertAcrIIA2
UseSynthetic BiologyTagsNo tag, No NLSExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYZ172
Plasmid#98409PurposeDonor DNA plasmid to introduce lys9 deletion in S. pombe. Linearization with Not1 digestion.DepositorInsertsupstream homologous region to delete lys9 in genome by recombination
downstream homologous region to delete lys9 in genome by recombination
UseCRISPR and Synthetic BiologyAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
-
pShoHELIX-sgRNA_entry (BO3)
Plasmid#181784PurposeExpresses ShoHELIX containing a nicking I-AniI fusion to ShoTnsB. New sgRNA spacer sequences can be added using Golden Gate assembly (via SapI sites).DepositorInsertnAniI-ShoTnsB, ShoTnsC, ShoTniQ, ShoCas12k
ExpressionBacterialMutationnAniI = K227M, F80K, L232KPromoterLac and J23119Available SinceMarch 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
G1333 DddAtox-NādSpCas9
Plasmid#157833Purposeexpresses split DddAtox-Cas9 construct in mammalian cellsDepositorInsertbpNLSāG1333 DddAtox-NādSpCas9āUGIāUGIābpNLS
ExpressionMammalianAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-pU6-sgRNA
Plasmid#159174PurposeVector B encodes pAAV-pMecp2-dSaCas9-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of dSaCas9-sgRNA in neuronsDepositorInsertdSaCas9
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceNov. 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8ā¦PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA090
Plasmid#216099PurposeKnockout, EF1a-driven Cas12a (Cas only)DepositorInsertCas12a [EnAs]
UseCRISPR and Lentiviral; Assembled vectorAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP2262
Plasmid#70703PurposeBacterial expression plasmid for Sa-dCas9 (D10A/H557A) & sgRNA targeted to site 1: T7-humanSadCas9-NLS-3xFLAG-T7-Sa-sgRNA(84) #1DepositorInsertsmammalian codon-optimized Staphylococcus aureus dCas9
SaCas9 sgRNA (+84)
UseCRISPRTagsNLS-3xFLAGExpressionBacterialMutationD10A & H557A in SaCas9PromoterT7Available SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Consensus
Plasmid#176664PurposeExpression of sgRNA under mosquito consensus U6 promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUb dRxCas13d + RxCas13d guide RNA
Plasmid#176304PurposeExpresses catalytic dead RxCas13d and its associated guide RNA in Drosophila cellsDepositorInsertRxCas13d
TagsHA tagExpressionInsectMutationR239A, H244A, R858A, H863APromoterUbi-p63eAvailable SinceMarch 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B3
Plasmid#172844PurposeCRISPIE donor B3 (Zhong et al, eLife 2021), mTurquoise2 translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mTurquoise2
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1223
Plasmid#119261Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJMP1221
Plasmid#119260Purposerfp "test" strainDepositorInsertsgRNA NT1/RR1 (rfp)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Aaeg_774
Plasmid#176659PurposeExpression of sgRNA under Ae. Aegypti U6 (AAEL017774) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceDec. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B4
Plasmid#172845PurposeCRISPIE donor B4 (Zhong et al, eLife 2021), mNeonGreen translational phase (0-0), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-0) encoding mNeonGreen
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLib6.4-Agam_695
Plasmid#176654PurposeExpression of sgRNA under An. gambiae U6-2 (AGAP013695) promoter & delivery of D.mel-Actin5C::EGFP-2A-puro|sgRNA cassette through PhiC31 RCME to AttP acceptor cell line/organismDepositorTypeEmpty backboneUseCrisprExpressionInsectAvailable SinceNov. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP1335
Plasmid#119269Purposerfp "test" strainDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p944-SWITCH-OVER insert: EF1a-Puro
Plasmid#217891Purposeinsert vector for Switch-OVER: Single loxP-STOP-EF1a-Puro-mU6DepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBsVchCAST
Plasmid#203812PurposeExpression of CRISPR-associated transposases, shuttle vector for Bacillus subtilis / E. coliDepositorInsertVchTniQ, VchCas5/8, VchCas7, VchCas6, VchTnsABC
UseCRISPRExpressionBacterialAvailable SinceAug. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJG85
Plasmid#89281PurposeEntry vector containing the TaU6 promoter and an Esp3I Golden Gate cloning site for cloning of the sgRNA, all between attL5 and attL2 sitesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceMay 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ262m3
Plasmid#149556PurposeGateway entry clone for CRISPR-iSpyMacCas9 ABE7.10 A-G base editing at NAAR PAMsDepositorInsertecTadAwt-ecTadAmut-ziSpyMacCas9(D10A)
UseCRISPRExpressionPlantMutationD10A, R221K, N394K, Protospacer interacting domaiā¦Available SinceJuly 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJMP1363
Plasmid#119279Purposefor stabilizing ICE in the presence of rapI expressionDepositorInsertdcas9
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only